HUGE

Gene/Protein Characteristic Table for KIAA0916

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06069
Accession No. :	AB020723
Description :	Probable E3 ubiquitin-protein ligase MYCBP2.
HUGO Gene Name :	MYC binding protein 2 (MYCBP2)
Clone Name :	hk06582s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk06582, former representative clones for KIAA0916 with hk06582s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4354 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 720 bp

Genome contig ID gi51511729r_76416794
PolyA signal sequence
(GATAAA,-10)
+----*----+----*----+----*----+----
AAACCACTGTACATTTTTATACAGTGATAAAGTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCACTGTGGGAGGTATTGTTTAAAAAACAAAATTTGAACACCTTTAAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 76516794 76562363 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75592	100.0	Probable E3 ubi...	Homo sapiens
XP_001140575	99.9	MYC binding pro...	Pan troglodytes
AAC39928	99.9	protein associa...	Homo sapiens
XP_857946	99.5	similar to Prob...	Canis lupus fam...
EAW80566	99.8	MYC binding pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001841 960 1010 SM00184 Zinc finger

ProfileScan IPR001841 960 1011 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001841	960	1010	SM00184	Zinc finger
ProfileScan	IPR001841	960	1011	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGGCCTGTGAAGCATTGGAC

Primer_r
: CTCTTTTTATCCCCACCCGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	720 bp
Genome contig ID	gi51511729r_76416794
PolyA signal sequence (GATAAA,-10)	+--------+--------+----*----+---- AAACCACTGTACATTTTTATACAGTGATAAAGTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCACTGTGGGAGGTATTGTTTAAAAAACAAAATTTGAACACCTTTAAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	76516794	76562363	24	100.0	Perfect prediction

Primer_f	: TTGGCCTGTGAAGCATTGGAC
Primer_r	: CTCTTTTTATCCCCACCCGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0916

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information