| HUGE | 
Gene/Protein Characteristic Table for KIAA0917 | 
| 
Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK02003 | 
|---|---|
| Accession No. : | AB020724 | 
| Description : | Sec1 family domain-containing protein 1. | 
| HUGO Gene Name : | sec1 family domain containing 1 (SCFD1) | 
| Clone Name : | hk07974s2 [Vector Info] | 
| Flexi ORF Clone : | pF1KA0917
                   ![]()  | 
| Source : | Human adult brain | 
| Note : | We replaced hk07974, former representative clones for KIAA0917 with hk07974s2. (2003/8/28) | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 2135 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | YES | 
Warning for coding interruption:  | NO | 
Length of 3'UTR 186 bp Genome contig ID gi51511730f_30061276 PolyA signal sequence 
(ATTAAA,-23) +----*----+----*----+----*----+----
TAATATGTATTGATTAAAAGAAACATTTCAGAAATFlanking genome sequence 
(213478 - 213527) ----+----*----+----*----+----*----+----*----+----*
AAAATTTCAACATTGTTCATTTTCTCTGATAAATCAGAAAGTACTAATAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 30161276 30274752 25 100.0 Perfect prediction 
Features of the protein sequence | 
Description | |
|---|---|---|
Length: 648 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
    Expression profile | 
Description | |
|---|---|---|
| RT-PCR-ELISA | Description | 
|---|

Experimental conditions
| : TGGAGATGAAGTCAAACCCCG | |
| : ATGTAGTTGCCTCCTCCCACC | |
| : 95 °C | 
RH mapping information | 
Description | |
|---|---|---|
| : 14 | 
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - | 
| 
 
 How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage  
 
  | |