HUGE

Gene/Protein Characteristic Table for KIAA0927

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00686
Accession No. :	AB023144
Description :	Seizure 6-like protein precursor.
HUGO Gene Name :
Clone Name :	hg03734 [Vector Info]
Flexi ORF Clone :	pF1KSDA0927
Source :	Human adult brain
Note :	We replaced hh02994, former representative clones for KIAA0927 with hg03734. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 6301 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3295 bp

Genome contig ID gi89161203f_24795480
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGTATATATTGATGCTAATAAAACAGATGAAAAAG
Flanking genome sequence
(314083 - 314132)
----+----*----+----*----+----*----+----*----+----*
ACTCAAGTGTGTAGAATTTTTGTTACAGACACTTCAGGATGGCACCAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 24895480 25109561 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1001 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515042	99.3	seizure related...	Pan troglodytes
CAI19980	100.0	seizure related...	Homo sapiens
CAG30460	94.5	SEZ6L [Homo sap...	Homo sapiens
AAI43855	93.4	Unknown (protei...	Homo sapiens
AAQ88771	92.7	SEZ6L [Homo sap...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067477	7.3e-22	32.3	KIAA1890
AB067481	2.7e-19	30.6	KIAA1894

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000436 445 500 PF00084 Sushi/SCR/CCP

IPR000859 504 548 PF00431 CUB

IPR000436 619 676 PF00084 Sushi/SCR/CCP

IPR000859 680 772 PF00431 CUB

IPR000436 797 852 PF00084 Sushi/SCR/CCP

IPR000436 861 918 PF00084 Sushi/SCR/CCP

HMMSmart IPR000859 333 441 SM00042 CUB

IPR000436 445 500 SM00032 Sushi/SCR/CCP

IPR000859 504 614 SM00042 CUB

IPR000436 619 676 SM00032 Sushi/SCR/CCP

IPR000859 680 791 SM00042 CUB

IPR000436 797 852 SM00032 Sushi/SCR/CCP

IPR000436 861 918 SM00032 Sushi/SCR/CCP

ProfileScan IPR000859 333 441 PS01180 CUB

IPR000436 443 502 PS50923 Sushi/SCR/CCP

IPR000859 504 614 PS01180 CUB

IPR000436 617 678 PS50923 Sushi/SCR/CCP

IPR000859 680 791 PS01180 CUB

IPR000436 795 854 PS50923 Sushi/SCR/CCP

IPR000436 859 920 PS50923 Sushi/SCR/CCP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000436	445	500	PF00084	Sushi/SCR/CCP
IPR000859	504	548	PF00431	CUB
IPR000436	619	676	PF00084	Sushi/SCR/CCP
IPR000859	680	772	PF00431	CUB
IPR000436	797	852	PF00084	Sushi/SCR/CCP
IPR000436	861	918	PF00084	Sushi/SCR/CCP
HMMSmart	IPR000859	333	441	SM00042	CUB
IPR000436	445	500	SM00032	Sushi/SCR/CCP
IPR000859	504	614	SM00042	CUB
IPR000436	619	676	SM00032	Sushi/SCR/CCP
IPR000859	680	791	SM00042	CUB
IPR000436	797	852	SM00032	Sushi/SCR/CCP
IPR000436	861	918	SM00032	Sushi/SCR/CCP
ProfileScan	IPR000859	333	441	PS01180	CUB
IPR000436	443	502	PS50923	Sushi/SCR/CCP
IPR000859	504	614	PS01180	CUB
IPR000436	617	678	PS50923	Sushi/SCR/CCP
IPR000859	680	791	PS01180	CUB
IPR000436	795	854	PS50923	Sushi/SCR/CCP
IPR000436	859	920	PS50923	Sushi/SCR/CCP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 934 MALAIFIPVLIISLLLGGAYIYI 956 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	934	MALAIFIPVLIISLLLGGAYIYI	956	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCATAATCAGGAGGGTTGTA

Primer_r
: TATCTGACCTCAAATGACTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3295 bp
Genome contig ID	gi89161203f_24795480
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTATATATTGATGCTAATAAAACAGATGAAAAAG
Flanking genome sequence (314083 - 314132)	----+--------+--------+--------+--------+----* ACTCAAGTGTGTAGAATTTTTGTTACAGACACTTCAGGATGGCACCAAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	24895480	25109561	15	99.3	Perfect prediction

Primer_f	: TGCATAATCAGGAGGGTTGTA
Primer_r	: TATCTGACCTCAAATGACTCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0927

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information