HUGE

Gene/Protein Characteristic Table for KIAA0929

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06961
Accession No. :	AB023146
Description :	Msx2-interacting protein.
HUGO Gene Name :	spen homolog, transcriptional regulator (Drosophila) (SPEN)
Clone Name :	hh03374 [Vector Info]
Flexi ORF Clone :	pF1KA0929
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6022 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1028 bp

Genome contig ID gi89161185f_16031324
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TTGGATTACAAACTTTATTAAAAAATATAAAACAC
Flanking genome sequence
(108215 - 108264)
----+----*----+----*----+----*----+----*----+----*
ACCAAGTGTGAGTGTGATTGTCACTTGGGTGGGAGGACGAACCATGGGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 16131324 16139537 5 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1663 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB51072	0	100.0	hypothetical pr...	Homo sapiens
BAG10400	0	100.0	spen homolog, t...	synthetic construct
Q96T58	0	100.0	Msx2-interactin...	Homo sapiens
EAW51756	0	99.9	spen homolog, t...	Homo sapiens
EDL80993	9.5e-214	77.1	rCG30673 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012921 1508 1629 PF07744 Spen paralogue and orthologue C-terminal

ProfileScan IPR010912 1497 1663 PS50917 Spen paralogue and orthologue C-terminal

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012921	1508	1629	PF07744	Spen paralogue and orthologue C-terminal
ProfileScan	IPR010912	1497	1663	PS50917	Spen paralogue and orthologue C-terminal

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCCCTCTTCCTATTACCTTG

Primer_r
: ACACAAAACAAAACTGCGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1028 bp
Genome contig ID	gi89161185f_16031324
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTGGATTACAAACTTTATTAAAAAATATAAAACAC
Flanking genome sequence (108215 - 108264)	----+--------+--------+--------+--------+----* ACCAAGTGTGAGTGTGATTGTCACTTGGGTGGGAGGACGAACCATGGGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	16131324	16139537	5	100.0	Perfect prediction

Primer_f	: ACCCCTCTTCCTATTACCTTG
Primer_r	: ACACAAAACAAAACTGCGCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0929

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information