HUGE

Gene/Protein Characteristic Table for KIAA0933

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04825
Accession No. :	AB023150
Description :	Uncharacterized protein C21orf5.
HUGO Gene Name :	dopey family member 2 (DOPEY2)
Clone Name :	hh04045s1 [Vector Info]
Flexi ORF Clone :	pF1KA0933
Source :	Human adult brain
Note :	We replaced hh04045, former representative clones for KIAA0933 with hh04045s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6994 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 549 bp

Genome contig ID gi51511750f_36394631
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATTTATGTAATGAAAATAAAATTAATATATCATCT
Flanking genome sequence
(193659 - 193708)
----+----*----+----*----+----*----+----*----+----*
AACAGTAGCACAAAATTTGTAATATGAAGTAAAGTATGAAGATAATGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 f 36494631 36588288 34 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2147 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA89431	100.0	C21orf5 [Homo s...	Homo sapiens
Q9Y3R5	99.9	Protein dopey-2.	Homo sapiens
XP_531552	99.7	pad-1-like isof...	Pan troglodytes
CAB41415	99.6	hypothetical pr...	Homo sapiens
XP_544874	89.4	similar to pad-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029040	5.8e-121	38.1	KIAA1117

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007249 1 163 PF04118 Dopey

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007249	1	163	PF04118	Dopey

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCACACTGTCAGGATTCTAG

Primer_r
: CTGTCTCTGGGTCTTAAATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	549 bp
Genome contig ID	gi51511750f_36394631
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATTTATGTAATGAAAATAAAATTAATATATCATCT
Flanking genome sequence (193659 - 193708)	----+--------+--------+--------+--------+----* AACAGTAGCACAAAATTTGTAATATGAAGTAAAGTATGAAGATAATGAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	f	36494631	36588288	34	99.7	Perfect prediction

Primer_f	: CCCACACTGTCAGGATTCTAG
Primer_r	: CTGTCTCTGGGTCTTAAATGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0933

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information