HUGE

Gene/Protein Characteristic Table for KIAA1117

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04824
Accession No. :	AB029040
Description :	dopey family member 1.
HUGO Gene Name :
Clone Name :	hj06748 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk07169, former representative clones for KIAA1117 with hj06748. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 4983 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 304 bp

Genome contig ID gi89161210f_83798717
PolyA signal sequence
(AATATA,-26)
+----*----+----*----+----*----+----
AACCTGCAAAATATACACTACCCATTTTTTTTTTC
Flanking genome sequence
(136194 - 136243)
----+----*----+----*----+----*----+----*----+----*
CATTGGTTTCAGACTTGGTTCAATTAAGATTGGTTGGGGATTTTTCTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 83898717 83934909 22 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1558 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW48676	100.0	dopey family me...	Homo sapiens
EAW48674	100.0	dopey family me...	Homo sapiens
Q5JWR5	100.0	Protein dopey-1.	Homo sapiens
AAI50620	99.9	DOPEY1 protein ...	Homo sapiens
XP_532215	96.5	similar to pad-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023150	1.7e-120	38.0	KIAA0933

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAATGTCTGAATGTGGCCTG

Primer_r
: GGGTAGTGTATATTTTGCAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAAATGTCTGAATGTGGCCTG
Primer_r	: GGGTAGTGTATATTTTGCAGG
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	304 bp
Genome contig ID	gi89161210f_83798717
PolyA signal sequence (AATATA,-26)	+--------+--------+----*----+---- AACCTGCAAAATATACACTACCCATTTTTTTTTTC
Flanking genome sequence (136194 - 136243)	----+--------+--------+--------+--------+----* CATTGGTTTCAGACTTGGTTCAATTAAGATTGGTTGGGGATTTTTCTCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	83898717	83934909	22	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1117

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information