HUGE

Gene/Protein Characteristic Table for KIAA0940

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00691
Accession No. :	AB023157
Description :	Cytoplasmic polyadenylation element-binding protein 3.
HUGO Gene Name :	cytoplasmic polyadenylation element binding protein 3 (CPEB3)
Clone Name :	hh04894 [Vector Info]
Flexi ORF Clone :	pF1KSDA0940
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5715 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3571 bp

Genome contig ID gi89161187r_93698379
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGGATAATTGGGTAATAAAATGACAGAATGAGCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATGTGAGATTTTGAGAAGCCTTTTCCTTTATCACAGTGGTTTAGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 93798379 93992983 10 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI13637	4e-185	100.0	cytoplasmic pol...	Homo sapiens
XP_001145214	1.2e-184	99.9	cytoplasmic pol...	Pan troglodytes
XP_001088983	7.9e-183	98.8	similar to cyto...	Macaca mulatta
XP_543930	7.4e-181	97.7	similar to cyto...	Canis lupus fam...
BAE36436	1.8e-138	94.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051460	4.8e-38	59.9	KIAA1673

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 444 505 PF00076 RNA recognition motif

HMMSmart IPR000504 443 515 SM00360 RNA recognition motif

IPR000504 551 624 SM00360 RNA recognition motif

ProfileScan IPR000504 442 529 PS50102 RNA recognition motif

IPR000504 550 628 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	444	505	PF00076	RNA recognition motif
HMMSmart	IPR000504	443	515	SM00360	RNA recognition motif
IPR000504	551	624	SM00360	RNA recognition motif
ProfileScan	IPR000504	442	529	PS50102	RNA recognition motif
IPR000504	550	628	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCATAAAGCTAAAGTGAAGGC

Primer_r
: TCAGTCGCGCACAATCAACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCATAAAGCTAAAGTGAAGGC
Primer_r	: TCAGTCGCGCACAATCAACAC
PCR product length	: 153 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3571 bp
Genome contig ID	gi89161187r_93698379
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGGATAATTGGGTAATAAAATGACAGAATGAGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATGTGAGATTTTGAGAAGCCTTTTCCTTTATCACAGTGGTTTAGTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	93798379	93992983	10	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0940

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information