HUGE

Gene/Protein Characteristic Table for KIAA0945

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01615
Accession No. :	AB023162
Description :	Bromo adjacent homology domain-containing 1 protein.
HUGO Gene Name :	bromo adjacent homology domain containing 1 (BAHD1)
Clone Name :	hj04760 [Vector Info]
Flexi ORF Clone :	pF1KSDA0945
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4696 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2097 bp

Genome contig ID gi51511731f_38419212
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
GAAAAAAATAAATTTGAGAAATTGTATTGATTTAG
Flanking genome sequence
(128510 - 128559)
----+----*----+----*----+----*----+----*----+----*
AAAAGGATCGTTTCCTGTGTGTCCTGTCATCTTTTGGTGTGTGGGTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 38519212 38547720 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 797 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09910	100.0	bromo adjacent ...	synthetic construct
EAW92418	99.9	bromo adjacent ...	Homo sapiens
Q8TBE0	99.7	Bromo adjacent ...	Homo sapiens
AAH22782	99.7	Bromo adjacent ...	Homo sapiens
XP_001096466	98.3	similar to brom...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001025 641 737 PF01426 Bromo adjacent region

HMMSmart IPR001025 641 796 SM00439 Bromo adjacent region

ProfileScan IPR001025 641 796 PS51038 Bromo adjacent region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001025	641	737	PF01426	Bromo adjacent region
HMMSmart	IPR001025	641	796	SM00439	Bromo adjacent region
ProfileScan	IPR001025	641	796	PS51038	Bromo adjacent region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAAATGAGGTTGGCAGAGTGG

Primer_r
: GCATTTAAGTTCGGGGCAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAAATGAGGTTGGCAGAGTGG
Primer_r	: GCATTTAAGTTCGGGGCAGCC
PCR product length	: 163 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2097 bp
Genome contig ID	gi51511731f_38419212
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- GAAAAAAATAAATTTGAGAAATTGTATTGATTTAG
Flanking genome sequence (128510 - 128559)	----+--------+--------+--------+--------+----* AAAAGGATCGTTTCCTGTGTGTCCTGTCATCTTTTGGTGTGTGGGTGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	38519212	38547720	7	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0945

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information