HUGE

Gene/Protein Characteristic Table for KIAA0947

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01137
Accession No. :	AB023164
Description :
HUGO Gene Name :
Clone Name :	ef03552 [Vector Info]
Flexi ORF Clone :	pF1KA0947
Source :
Note :	We replaced hj04847 and hj04847s1, former representative clones for KIAA0947 with ef03552. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7903 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 880 bp

Genome contig ID gi51511721f_5375807
PolyA signal sequence
(AATAAA,-9)
+----*----+----*----+----*----+----
CTCTTGTATGTGTTTTTATAATAAAAAATAAAAGT
Flanking genome sequence
(167518 - 167567)
----+----*----+----*----+----*----+----*----+----*
AAGCCATGGATATTACTGTTCTGATTATTAGAGTGAAACTGGGTGTTACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 5475807 5543323 18 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 2330 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056140	99.9	hypothetical pr...	Homo sapiens
CAH18279	99.8	hypothetical pr...	Homo sapiens
CAD97966	99.9	hypothetical pr...	Homo sapiens
EAX08113	100.0	hCG16543 [Homo ...	Homo sapiens
XP_545182	63.5	similar to muci...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTGTTGTTGTTGGACTTGTG

Primer_r
: AAGTGGGTTTCTGCTAAGGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	880 bp
Genome contig ID	gi51511721f_5375807
PolyA signal sequence (AATAAA,-9)	+--------+--------+----*----+---- CTCTTGTATGTGTTTTTATAATAAAAAATAAAAGT
Flanking genome sequence (167518 - 167567)	----+--------+--------+--------+--------+----* AAGCCATGGATATTACTGTTCTGATTATTAGAGTGAAACTGGGTGTTACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	5475807	5543323	18	99.3	Perfect prediction

Primer_f	: GCTGTTGTTGTTGGACTTGTG
Primer_r	: AAGTGGGTTTCTGCTAAGGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0947

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information