HUGE |
Gene/Protein Characteristic Table for KIAA0954 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04311 |
---|---|
Accession No. : | AB023171 |
Description : | Uncharacterized protein C11orf9 (Fragment). |
HUGO Gene Name : | |
Clone Name : | hj05543s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0954 |
Source : | Human adult brain |
Note : | We replaced hj05543, former representative clones for KIAA0954 with hj05543s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5926 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2374 bp Genome contig ID gi51511727f_61176697 PolyA signal sequence
(AATAAA,-30) +----*----+----*----+----*----+----
ATATAAATAAATGTATAAATACTGCTTTGTATCTGFlanking genome sequence
(135870 - 135919) ----+----*----+----*----+----*----+----*----+----*
AGCTTGCCTCCTTGTCTCTTCTTGGGATTGGTCTGGTGGGAGAGGAGTCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 61276697 61312565 27 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1183 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTTTGTTCCTGTAGTCACTGG | |
: CACATGACAAATACCAAGCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |