HUGE

Gene/Protein Characteristic Table for KIAA0955

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00695
Accession No. :	AB023172
Description :	Caspase recruitment domain-containing protein 8.
HUGO Gene Name :	caspase recruitment domain family, member 8 (CARD8)
Clone Name :	hj05544 [Vector Info]
Flexi ORF Clone :	pF1KSDA0955
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5059 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3450 bp

Genome contig ID gi42406306r_53303325
PolyA signal sequence
(CATAAA,-23)
+----*----+----*----+----*----+----
GGCGTTAGAATTCATAAAAGTCTTTATATGCTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCTGCAGCTCCATCCTCTTCATGATTGTGATCGTAAGGACAGTGGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 53403325 53444737 10 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 485 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABW96892	4e-193	99.1	CARD8 isoform T...	Homo sapiens
Q9Y2G2	7.9e-186	100.0	Caspase recruit...	Homo sapiens
AAL02427	2.5e-184	99.3	CARD-inhibitor ...	Homo sapiens
XP_001170553	2.7e-182	97.9	caspase recruit...	Pan troglodytes
XP_001170291	6.3e-181	92.7	caspase recruit...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023143	9.5e-34	38.5	KIAA0926

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001315 399 483 PF00619 Caspase Recruitment

ProfileScan IPR001315 401 484 PS50209 Caspase Recruitment

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001315	399	483	PF00619	Caspase Recruitment
ProfileScan	IPR001315	401	484	PS50209	Caspase Recruitment

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTAAATCAACTCCACAGAAC

Primer_r
: GGTAGAATCCAAATGTCAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3450 bp
Genome contig ID	gi42406306r_53303325
PolyA signal sequence (CATAAA,-23)	+--------+--------+----*----+---- GGCGTTAGAATTCATAAAAGTCTTTATATGCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGCAGCTCCATCCTCTTCATGATTGTGATCGTAAGGACAGTGGAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	53403325	53444737	10	99.2	Perfect prediction

Primer_f	: GGTAAATCAACTCCACAGAAC
Primer_r	: GGTAGAATCCAAATGTCAGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0955

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information