HUGE |
Gene/Protein Characteristic Table for KIAA0955 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00695 |
---|---|
Accession No. : | AB023172 |
Description : | Caspase recruitment domain-containing protein 8. |
HUGO Gene Name : | caspase recruitment domain family, member 8 (CARD8) |
Clone Name : | hj05544 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0955
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5059 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3450 bp Genome contig ID gi42406306r_53303325 PolyA signal sequence
(CATAAA,-23) +----*----+----*----+----*----+----
GGCGTTAGAATTCATAAAAGTCTTTATATGCTCAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTCTGCAGCTCCATCCTCTTCATGATTGTGATCGTAAGGACAGTGGAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 53403325 53444737 10 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 485 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GGTAAATCAACTCCACAGAAC | |
: GGTAGAATCCAAATGTCAGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |