HUGE |
Gene/Protein Characteristic Table for KIAA0926 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00148 |
---|---|
Accession No. : | AB023143 |
Description : | NACHT, LRR and PYD domains-containing protein 1. |
HUGO Gene Name : | NLR family, pyrin domain containing 1 (NLRP1) |
Clone Name : | hh02962 [Vector Info] |
Flexi ORF Clone : | pF1KA0926
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5444 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 632 bp Genome contig ID gi51511734r_5258396 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
AAAAAATGAAAATAAAGGAATAAGAAGTTACCTACFlanking genome sequence
(99770 - 99721) ----+----*----+----*----+----*----+----*----+----*
TCCATAGGCACAGCAGTCCCGACTGGCTGCTGGTTGGCTATTTTTGTGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 5358166 5428523 16 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1447 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATCTCATGCCTGCAACTACTC | |
: CAACCTCCACCGATGTCACTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: GeneBridge 4 | |
: ATCTCATGCCTGCAACTACTC | |
: CAACCTCCACCGATGTCACTC | |
: 135 (0.5k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |