HUGE

Gene/Protein Characteristic Table for KIAA0926

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00148
Accession No. :	AB023143
Description :	NACHT, LRR and PYD domains-containing protein 1.
HUGO Gene Name :	NLR family, pyrin domain containing 1 (NLRP1)
Clone Name :	hh02962 [Vector Info]
Flexi ORF Clone :	pF1KA0926
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5444 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 632 bp

Genome contig ID gi51511734r_5258396
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAAAAATGAAAATAAAGGAATAAGAAGTTACCTAC
Flanking genome sequence
(99770 - 99721)
----+----*----+----*----+----*----+----*----+----*
TCCATAGGCACAGCAGTCCCGACTGGCTGCTGGTTGGCTATTTTTGTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 5358166 5428523 16 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1447 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG30288	100.0	NALP1 [Homo sap...	Homo sapiens
EAW90327	99.9	NACHT, leucine ...	Homo sapiens
EAW90323	99.8	NACHT, leucine ...	Homo sapiens
AAG15254	99.4	caspase recruit...	Homo sapiens
XP_523840	97.0	death effector ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023172	1.4e-20	38.9	KIAA0955

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000767 347 362 PR00364 Disease resistance protein

IPR000767 417 431 PR00364 Disease resistance protein

IPR000767 823 839 PR00364 Disease resistance protein

IPR001611 828 841 PR00019 Leucine-rich repeat

IPR001611 939 952 PR00019 Leucine-rich repeat

HMMPfam IPR004020 23 106 PF02758 Pyrin

IPR007111 346 515 PF05729 NACHT nucleoside triphosphatase

IPR001611 827 850 PF00560 Leucine-rich repeat

IPR001611 884 907 PF00560 Leucine-rich repeat

IPR001611 941 959 PF00560 Leucine-rich repeat

IPR001315 1353 1436 PF00619 Caspase Recruitment

HMMSmart IPR003590 825 852 SM00368 Leucine-rich repeat

IPR003590 854 881 SM00368 Leucine-rich repeat

IPR003590 882 909 SM00368 Leucine-rich repeat

IPR003590 911 938 SM00368 Leucine-rich repeat

IPR003590 939 966 SM00368 Leucine-rich repeat

ProfileScan IPR004020 19 110 PS50824 Pyrin

IPR007111 346 655 PS50837 NACHT nucleoside triphosphatase

IPR001315 1354 1437 PS50209 Caspase Recruitment

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000767	347	362	PR00364	Disease resistance protein
IPR000767	417	431	PR00364	Disease resistance protein
IPR000767	823	839	PR00364	Disease resistance protein
IPR001611	828	841	PR00019	Leucine-rich repeat
IPR001611	939	952	PR00019	Leucine-rich repeat
HMMPfam	IPR004020	23	106	PF02758	Pyrin
IPR007111	346	515	PF05729	NACHT nucleoside triphosphatase
IPR001611	827	850	PF00560	Leucine-rich repeat
IPR001611	884	907	PF00560	Leucine-rich repeat
IPR001611	941	959	PF00560	Leucine-rich repeat
IPR001315	1353	1436	PF00619	Caspase Recruitment
HMMSmart	IPR003590	825	852	SM00368	Leucine-rich repeat
IPR003590	854	881	SM00368	Leucine-rich repeat
IPR003590	882	909	SM00368	Leucine-rich repeat
IPR003590	911	938	SM00368	Leucine-rich repeat
IPR003590	939	966	SM00368	Leucine-rich repeat
ProfileScan	IPR004020	19	110	PS50824	Pyrin
IPR007111	346	655	PS50837	NACHT nucleoside triphosphatase
IPR001315	1354	1437	PS50209	Caspase Recruitment

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATCTCATGCCTGCAACTACTC

Primer_r
: CAACCTCCACCGATGTCACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATCTCATGCCTGCAACTACTC
Primer_r	: CAACCTCCACCGATGTCACTC
PCR product length	: 135 (0.5k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	632 bp
Genome contig ID	gi51511734r_5258396
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAAAAATGAAAATAAAGGAATAAGAAGTTACCTAC
Flanking genome sequence (99770 - 99721)	----+--------+--------+--------+--------+----* TCCATAGGCACAGCAGTCCCGACTGGCTGCTGGTTGGCTATTTTTGTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	5358166	5428523	16	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0926

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information