HUGE

Gene/Protein Characteristic Table for KIAA0970

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01140
Accession No. :	AB023187
Description :	Fibronectin type-III domain-containing protein 3a.
HUGO Gene Name :	fibronectin type III domain containing 3A (FNDC3A)
Clone Name :	hh13674 [Vector Info]
Flexi ORF Clone :	pF1KA0970
Source :	Human adult brain
Note :	We replaced hj06711, former representative clones for KIAA0970 with hh13674. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 5844 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2388 bp

Genome contig ID gi51511729f_48486791
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CCAGTAAAGAATAAAATTAGAAGTTTTATCCTAGG
Flanking genome sequence
(195128 - 195177)
----+----*----+----*----+----*----+----*----+----*
TGACTTGATTTTGTGCAACTCATGAAATATCTTACTTCCTTTCCACATAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 48582510 48681917 24 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1151 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX08804	100.0	fibronectin typ...	Homo sapiens
CAI45989	99.8	hypothetical pr...	Homo sapiens
CAG44602	99.8	human gene expr...	Homo sapiens
XP_001152472	99.7	fibronectin typ...	Pan troglodytes
XP_001152540	99.6	fibronectin typ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040947	1.2e-05	24.8	KIAA1514
AB006621	0.00021	24.7	KIAA0283

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR003962 338 347 PR00014 Fibronectin

IPR003962 546 556 PR00014 Fibronectin

IPR003962 666 684 PR00014 Fibronectin

IPR003962 684 698 PR00014 Fibronectin

HMMPfam IPR003961 219 312 PF00041 Fibronectin

IPR003961 324 408 PF00041 Fibronectin

IPR003961 420 505 PF00041 Fibronectin

IPR003961 517 603 PF00041 Fibronectin

IPR003961 614 700 PF00041 Fibronectin

IPR003961 712 794 PF00041 Fibronectin

IPR003961 831 893 PF00041 Fibronectin

IPR003961 959 988 PF00041 Fibronectin

HMMSmart IPR003961 219 311 SM00060 Fibronectin

IPR003961 324 405 SM00060 Fibronectin

IPR003961 420 502 SM00060 Fibronectin

IPR003961 517 600 SM00060 Fibronectin

IPR003961 615 697 SM00060 Fibronectin

IPR003961 712 791 SM00060 Fibronectin

IPR003961 817 890 SM00060 Fibronectin

IPR003961 904 985 SM00060 Fibronectin

IPR003961 1000 1080 SM00060 Fibronectin

ProfileScan IPR003961 218 318 PS50853 Fibronectin

IPR003961 324 415 PS50853 Fibronectin

IPR003961 420 511 PS50853 Fibronectin

IPR003961 517 610 PS50853 Fibronectin

IPR003961 614 707 PS50853 Fibronectin

IPR003961 711 801 PS50853 Fibronectin

IPR003961 802 900 PS50853 Fibronectin

IPR003961 904 995 PS50853 Fibronectin

IPR003961 1000 1090 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003962	338	347	PR00014	Fibronectin
IPR003962	546	556	PR00014	Fibronectin
IPR003962	666	684	PR00014	Fibronectin
IPR003962	684	698	PR00014	Fibronectin
HMMPfam	IPR003961	219	312	PF00041	Fibronectin
IPR003961	324	408	PF00041	Fibronectin
IPR003961	420	505	PF00041	Fibronectin
IPR003961	517	603	PF00041	Fibronectin
IPR003961	614	700	PF00041	Fibronectin
IPR003961	712	794	PF00041	Fibronectin
IPR003961	831	893	PF00041	Fibronectin
IPR003961	959	988	PF00041	Fibronectin
HMMSmart	IPR003961	219	311	SM00060	Fibronectin
IPR003961	324	405	SM00060	Fibronectin
IPR003961	420	502	SM00060	Fibronectin
IPR003961	517	600	SM00060	Fibronectin
IPR003961	615	697	SM00060	Fibronectin
IPR003961	712	791	SM00060	Fibronectin
IPR003961	817	890	SM00060	Fibronectin
IPR003961	904	985	SM00060	Fibronectin
IPR003961	1000	1080	SM00060	Fibronectin
ProfileScan	IPR003961	218	318	PS50853	Fibronectin
IPR003961	324	415	PS50853	Fibronectin
IPR003961	420	511	PS50853	Fibronectin
IPR003961	517	610	PS50853	Fibronectin
IPR003961	614	707	PS50853	Fibronectin
IPR003961	711	801	PS50853	Fibronectin
IPR003961	802	900	PS50853	Fibronectin
IPR003961	904	995	PS50853	Fibronectin
IPR003961	1000	1090	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1125 QCAAVILVLFAFFSILIAFIIQY 1147 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1125	QCAAVILVLFAFFSILIAFIIQY	1147	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCATAACTGCTGCCACCAC

Primer_r
: AGCTTGAAGTTTACTGGTGCA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2388 bp
Genome contig ID	gi51511729f_48486791
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CCAGTAAAGAATAAAATTAGAAGTTTTATCCTAGG
Flanking genome sequence (195128 - 195177)	----+--------+--------+--------+--------+----* TGACTTGATTTTGTGCAACTCATGAAATATCTTACTTCCTTTCCACATAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	48582510	48681917	24	99.5	Perfect prediction

Primer_f	: TCCCATAACTGCTGCCACCAC
Primer_r	: AGCTTGAAGTTTACTGGTGCA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0970

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information