HUGE |
Gene/Protein Characteristic Table for KIAA0970 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01140 |
---|---|
Accession No. : | AB023187 |
Description : | Fibronectin type-III domain-containing protein 3a. |
HUGO Gene Name : | fibronectin type III domain containing 3A (FNDC3A) |
Clone Name : | hh13674 [Vector Info] |
Flexi ORF Clone : | pF1KA0970
![]() |
Source : | Human adult brain |
Note : | We replaced hj06711, former representative clones for KIAA0970 with hh13674. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5844 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2388 bp Genome contig ID gi51511729f_48486791 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
CCAGTAAAGAATAAAATTAGAAGTTTTATCCTAGGFlanking genome sequence
(195128 - 195177) ----+----*----+----*----+----*----+----*----+----*
TGACTTGATTTTGTGCAACTCATGAAATATCTTACTTCCTTTCCACATAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 f 48582510 48681917 24 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1151 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCCCATAACTGCTGCCACCAC | |
: AGCTTGAAGTTTACTGGTGCA | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |