HUGE

Gene/Protein Characteristic Table for KIAA0971

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00704
Accession No. :	AB023188
Description :	FAST kinase domain-containing protein 2.
HUGO Gene Name :
Clone Name :	hj06832 [Vector Info]
Flexi ORF Clone :	pF1KSDA0971
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4999 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2994 bp

Genome contig ID gi89161199f_207239611
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
CCTCAGTTCACTATTAAAATTAATTTTAGGAGTGG
Flanking genome sequence
(125306 - 125355)
----+----*----+----*----+----*----+----*----+----*
AAGAAATGTTGTTACTGCCATTTAAAAATATGCTGAGAAAATTCCAGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 207339604 207364915 9 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 665 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG50930	0	99.7	unnamed protein...	Homo sapiens
Q5R776	0	95.1	FAST kinase dom...	Pongo abelii
BAE87402	0	90.1	unnamed protein...	Macaca fascicularis
BAE01306	0	89.1	unnamed protein...	Macaca fascicularis
EDL00192	3.3e-177	63.6	FAST kinase dom...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010622 473 545 PF06743 FAST kinase leucine-rich

IPR013579 552 636 PF08368 FAST kinase-like protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010622	473	545	PF06743	FAST kinase leucine-rich
IPR013579	552	636	PF08368	FAST kinase-like protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGGAGATGGACAAACTAGAG

Primer_r
: TTACAGCAGCAACAGGAAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGGAGATGGACAAACTAGAG
Primer_r	: TTACAGCAGCAACAGGAAGAG
PCR product length	: 91 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2994 bp
Genome contig ID	gi89161199f_207239611
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- CCTCAGTTCACTATTAAAATTAATTTTAGGAGTGG
Flanking genome sequence (125306 - 125355)	----+--------+--------+--------+--------+----* AAGAAATGTTGTTACTGCCATTTAAAAATATGCTGAGAAAATTCCAGAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	207339604	207364915	9	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0971

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information