HUGE |
Gene/Protein Characteristic Table for KIAA0979 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01619 |
---|---|
Accession No. : | AB023196 |
Description : | Androgen-induced proliferation inhibitor. |
HUGO Gene Name : | PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) (PDS5B) |
Clone Name : | hj07056s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0979
![]() |
Source : | Human adult brain |
Note : | We replaced hj07056, former representative clones for KIAA0979 with hj07056s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5309 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 857 bp Genome contig ID gi51511729f_31958651 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
ATCTACTGTATCAATAAAATTCTGTAATTTGAATGFlanking genome sequence
(289394 - 289443) ----+----*----+----*----+----*----+----*----+----*
AGTTTTTAATAGTCTAGAATGTTATTGTGTATAGATATTTCCTCTTGAAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 f 32058642 32248043 35 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1483 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGATGTCACTATTTGTTGGAG | |
: TTGCATGGTTGTCCTCCTATC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |