HUGE

Gene/Protein Characteristic Table for KIAA0648

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06318
Accession No. :	AB014548
Description :	PDS5, regulator of cohesion maintenance, homolog A isoform 1.
HUGO Gene Name :	PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) (PDS5A)
Clone Name :	hj03994 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5177 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 851 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM82347	100.0	SCC-112 [Homo s...	Homo sapiens
CAH18263	100.0	hypothetical pr...	Homo sapiens
Q29RF7	100.0	Sister chromati...	Homo sapiens
EAW92955	100.0	SCC-112 protein...	Homo sapiens
XP_526554	100.0	SCC-112 protein...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023196	4.5e-150	62.3	KIAA0979

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAAGTCCCTCAAGCAATCAG

Primer_r
: TGACACACTGGAAACCTTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGAAGTCCCTCAAGCAATCAG
Primer_r	: TGACACACTGGAAACCTTAGG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0648

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information