| HUGE |
Gene/Protein Characteristic Table for KIAA0982 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00160 |
|---|---|
| Accession No. : | AB023199 |
| Description : | WD repeat protein 37. |
| HUGO Gene Name : | WD repeat domain 37 (WDR37) |
| Clone Name : | hj07125 [Vector Info] |
| Flexi ORF Clone : | pF1KA0982
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4586 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2957 bp Genome contig ID gi89161187f_985478 PolyA signal sequence
(AATATA,-20)
GCTAGAAATTGAACAAATATAATACTGGTCACTCGFlanking genome sequence
(182761 - 182810)
AAAAATTTTTAGACTTAAAAAGTCAGTTGTGTTTTGTGTCTGTCTCTTAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 1085478 1168237 14 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 502 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : AAGTCAATATTCCTAGTGGCC | |
| : CACATTAGAAGACGACACAGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 10 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
