HUGE

Gene/Protein Characteristic Table for KIAA0984

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05629
Accession No. :	AB023201
Description :
HUGO Gene Name :	TBC1 domain family, member 30 (TBC1D30)
Clone Name :	hj07670 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4701 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2512 bp

Genome contig ID gi89161190f_63407878
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
TAGAAAATAAAGAAACCTGCAGTAGCCTCTACCAC
Flanking genome sequence
(150474 - 150523)
----+----*----+----*----+----*----+----*----+----*
ACAGCATGTACAAAGACCAGTATGGACTTGCTATCTTCCCTATGTATTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 63466058 63558350 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 728 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAH16657	98.2	TBC1 domain fam...	Homo sapiens
EAW97144	99.8	hCG2014677, iso...	Homo sapiens
Q69ZT9	89.2	TBC1 domain fam...	Mus musculus
BAC31963	89.1	unnamed protein...	Mus musculus
CAH92459	89.3	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028978	2.7e-06	28.5	KIAA1055

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000195 50 283 PF00566 RabGAP/TBC

HMMSmart IPR000195 50 284 SM00164 RabGAP/TBC

ProfileScan IPR000195 53 261 PS50086 RabGAP/TBC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	50	283	PF00566	RabGAP/TBC
HMMSmart	IPR000195	50	284	SM00164	RabGAP/TBC
ProfileScan	IPR000195	53	261	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTTGAGGGATGTCTGACTTG

Primer_r
: GATACTAAGTTTGTGGACAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2512 bp
Genome contig ID	gi89161190f_63407878
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TAGAAAATAAAGAAACCTGCAGTAGCCTCTACCAC
Flanking genome sequence (150474 - 150523)	----+--------+--------+--------+--------+----* ACAGCATGTACAAAGACCAGTATGGACTTGCTATCTTCCCTATGTATTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	63466058	63558350	13	99.3	Perfect prediction

Primer_f	: CCTTGAGGGATGTCTGACTTG
Primer_r	: GATACTAAGTTTGTGGACAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0984

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information