HUGE

Gene/Protein Characteristic Table for KIAA1055

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK03292
Accession No. :	AB028978
Description :	TBC1 domain family, member 2B.
HUGO Gene Name :	TBC1 domain family, member 2B (TBC1D2B)
Clone Name :	hh09512 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5876 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3268 bp

Genome contig ID gi51511731r_75974383
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ACTAAAGGAAGAAATAAACTACTAATTTGTATAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCTGCATTGAAATTCAGTTATAGTCACTGGTGATGGGGCTCACCCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 76074383 76156912 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 868 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_055894	100.0	TBC1 domain fam...	Homo sapiens
Q9UPU7	100.0	TBC1 domain fam...	Homo sapiens
XP_510522	99.8	TBC1 domain fam...	Pan troglodytes
XP_001106607	97.8	similar to TBC1...	Macaca mulatta
EAW99190	100.0	TBC1 domain fam...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020689	1.5e-15	34.0	KIAA0882
AB014576	5.3e-14	32.5	KIAA0676
AB029031	2.1e-10	25.8	KIAA1108
AB011175	2.1e-09	21.4	KIAA0603
D13644	5.8e-09	24.1	KIAA0019

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000195 613 832 PF00566 RabGAP/TBC

HMMSmart IPR000195 613 833 SM00164 RabGAP/TBC

ProfileScan IPR001849 1 93 PS50003 Pleckstrin-like

IPR000195 616 810 PS50086 RabGAP/TBC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	613	832	PF00566	RabGAP/TBC
HMMSmart	IPR000195	613	833	SM00164	RabGAP/TBC
ProfileScan	IPR001849	1	93	PS50003	Pleckstrin-like
IPR000195	616	810	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 777 DYTLITFNWFLVVFVDSVVSDIL 799 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	777	DYTLITFNWFLVVFVDSVVSDIL	799	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATGTTTCACTGGGTAGACGG

Primer_r
: ACACTTGATTCGAGCAGACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3268 bp
Genome contig ID	gi51511731r_75974383
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ACTAAAGGAAGAAATAAACTACTAATTTGTATAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGCATTGAAATTCAGTTATAGTCACTGGTGATGGGGCTCACCCCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	76074383	76156912	13	99.4	Perfect prediction

Primer_f	: AATGTTTCACTGGGTAGACGG
Primer_r	: ACACTTGATTCGAGCAGACTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1055

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information