HUGE

Gene/Protein Characteristic Table for KIAA1108

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07061
Accession No. :	AB029031
Description :	TBC1 domain family member 1.
HUGO Gene Name :	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1)
Clone Name :	hh03387s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh03387, former representative clones for KIAA1108 with hh03387s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2576 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 284 bp

Genome contig ID gi89161207f_37605809
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATGGCGTGGACGTGAATAAATGCAACTTATGTTTT
Flanking genome sequence
(209828 - 209877)
----+----*----+----*----+----*----+----*----+----*
CTTGTTGGTTCCTTTTTGAGTGTCACTGTGTTTGTAAAGAGCATTCACAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 37705809 37815635 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 763 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH53648	100.0	TBC1D1 protein ...	Homo sapiens
AAH14529	100.0	TBC1D1 protein ...	Homo sapiens
EAW92889	100.0	hCG39018 [Homo ...	Homo sapiens
Q86TI0	100.0	TBC1 domain fam...	Homo sapiens
AAH50321	99.9	TBC1 (tre-2/USP...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011175	3.5e-82	52.3	KIAA0603
D13644	4.3e-13	26.9	KIAA0019
AB028978	1.1e-10	24.7	KIAA1055
AB020689	1.9e-10	27.4	KIAA0882
AB014576	6.3e-09	24.0	KIAA0676

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000195 392 611 PF00566 RabGAP/TBC

HMMSmart IPR000195 392 612 SM00164 RabGAP/TBC

ProfileScan IPR000195 395 589 PS50086 RabGAP/TBC

ScanRegExp IPR001220 121 127 PS00307 Legume lectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	392	611	PF00566	RabGAP/TBC
HMMSmart	IPR000195	392	612	SM00164	RabGAP/TBC
ProfileScan	IPR000195	395	589	PS50086	RabGAP/TBC
ScanRegExp	IPR001220	121	127	PS00307	Legume lectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCCAACTTGCAATTCAGGGG

Primer_r
: GCATTTATTCACGTCCACGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	284 bp
Genome contig ID	gi89161207f_37605809
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGGCGTGGACGTGAATAAATGCAACTTATGTTTT
Flanking genome sequence (209828 - 209877)	----+--------+--------+--------+--------+----* CTTGTTGGTTCCTTTTTGAGTGTCACTGTGTTTGTAAAGAGCATTCACAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	37705809	37815635	14	100.0	Perfect prediction

Primer_f	: CTCCAACTTGCAATTCAGGGG
Primer_r	: GCATTTATTCACGTCCACGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1108

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information