HUGE

Gene/Protein Characteristic Table for KIAA0882

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01130
Accession No. :	AB020689
Description :	TBC1 domain family member 9.
HUGO Gene Name :	TBC1 domain family, member 9 (with GRAM domain) (TBC1D9)
Clone Name :	hk07544s1 [Vector Info]
Flexi ORF Clone :	pF1KA0882
Source :	Human adult brain
Note :	We replaced hk07544, former representative clones for KIAA0882 with hk07544s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5286 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1410 bp

Genome contig ID gi89161207r_141661389
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GCTAAATGTGAACAAATAAAATACAGCAAATACTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATACAGCTTTTTATCTTTGTGCTTGAGTTCCTGCCTAAGGCAATAACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 141761389 141896724 21 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1291 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZT07	100.0	TBC1 domain fam...	Homo sapiens
XP_533283	97.5	similar to Y45F...	Canis lupus fam...
XP_001090502	100.0	similar to Y45F...	Macaca mulatta
Q3UYK3	95.9	TBC1 domain fam...	Mus musculus
BAE22209	95.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014576	0	62.9	KIAA0676
AB028978	1.4e-21	33.6	KIAA1055
AB029031	1.9e-14	27.4	KIAA1108
D13644	1.6e-12	27.6	KIAA0019
AB011175	2.2e-12	26.5	KIAA0603

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004182 171 238 PF02893 GRAM

IPR004182 318 386 PF02893 GRAM

IPR000195 537 749 PF00566 RabGAP/TBC

IPR002048 915 943 PF00036 Calcium-binding EF-hand

HMMSmart IPR004182 171 238 SM00568 GRAM

IPR004182 318 386 SM00568 GRAM

IPR000195 537 750 SM00164 RabGAP/TBC

ProfileScan IPR000195 540 727 PS50086 RabGAP/TBC

IPR002048 911 946 PS50222 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004182	171	238	PF02893	GRAM
IPR004182	318	386	PF02893	GRAM
IPR000195	537	749	PF00566	RabGAP/TBC
IPR002048	915	943	PF00036	Calcium-binding EF-hand
HMMSmart	IPR004182	171	238	SM00568	GRAM
IPR004182	318	386	SM00568	GRAM
IPR000195	537	750	SM00164	RabGAP/TBC
ProfileScan	IPR000195	540	727	PS50086	RabGAP/TBC
IPR002048	911	946	PS50222	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 696 STISLSWFLTLFLSVMPFESAVV 718 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	696	STISLSWFLTLFLSVMPFESAVV	718	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGTAGCAGCAAAGACAGAGG

Primer_r
: ATCCAGTATCAGAAGCATCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGTAGCAGCAAAGACAGAGG
Primer_r	: ATCCAGTATCAGAAGCATCAG
PCR product length	: 97 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1410 bp
Genome contig ID	gi89161207r_141661389
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCTAAATGTGAACAAATAAAATACAGCAAATACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATACAGCTTTTTATCTTTGTGCTTGAGTTCCTGCCTAAGGCAATAACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	141761389	141896724	21	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0882

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information