HUGE |
Gene/Protein Characteristic Table for KIAA0985 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00161 |
---|---|
Accession No. : | AB023202 |
Description : | Rabphilin-3A. |
HUGO Gene Name : | rabphilin 3A homolog (mouse) (RPH3A) |
Clone Name : | hj08038 [Vector Info] |
Flexi ORF Clone : | pF1KA0985
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4511 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2097 bp Genome contig ID gi89161190f_111614094 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
ATGATGTAGCCAAAAATAAAGTAGGAGCATCCAAGFlanking genome sequence
(206973 - 207022) ----+----*----+----*----+----*----+----*----+----*
AAAACGAGTGGTCTGCAGTTTTCCTTTCTGGTTTCTGCGAAGTCCTCCTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 111616764 111821065 23 99.6 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 697 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTTATCTTTCCCCATTAGTCC | |
: TGATTCCAGCGCCTACACCAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: CTTATCTTTCCCCATTAGTCC | |
: TGATTCCAGCGCCTACACCAG | |
: 128 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |