HUGE

Gene/Protein Characteristic Table for KIAA0985

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00161
Accession No. :	AB023202
Description :	Rabphilin-3A.
HUGO Gene Name :	rabphilin 3A homolog (mouse) (RPH3A)
Clone Name :	hj08038 [Vector Info]
Flexi ORF Clone :	pF1KA0985
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4511 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2097 bp

Genome contig ID gi89161190f_111614094
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATGATGTAGCCAAAAATAAAGTAGGAGCATCCAAG
Flanking genome sequence
(206973 - 207022)
----+----*----+----*----+----*----+----*----+----*
AAAACGAGTGGTCTGCAGTTTTCCTTTCTGGTTTCTGCGAAGTCCTCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 111616764 111821065 23 99.6 Terminal No-hit

Features of the protein sequence	Description

Length: 697 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2J0	5.8e-192	100.0	Rabphilin-3A; E...	Homo sapiens
BAH14483	9.4e-192	99.9	unnamed protein...	Homo sapiens
XP_001110574	2.4e-190	99.0	rabphilin 3A ho...	Macaca mulatta
AAH17259	7e-190	99.3	Rabphilin 3A ho...	Homo sapiens
CAH92404	1.2e-189	98.7	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001565 557 572 PR00399 Synaptotagmin

IPR001565 572 585 PR00399 Synaptotagmin

IPR000008 585 597 PR00360 C2 calcium-dependent membrane targeting

IPR000008 614 627 PR00360 C2 calcium-dependent membrane targeting

IPR001565 629 644 PR00399 Synaptotagmin

IPR000008 638 646 PR00360 C2 calcium-dependent membrane targeting

IPR001565 649 659 PR00399 Synaptotagmin

HMMPfam IPR003315 4 276 PF02318 Rabphilin-3A effector

IPR000008 412 501 PF00168 C2 calcium-dependent membrane targeting

IPR000008 570 658 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 411 516 SM00239 C2 calcium-dependent membrane targeting

IPR000008 569 683 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR010911 47 163 PS50916 Rab-binding

IPR000306 95 151 PS50178 Zinc finger

IPR000008 410 501 PS50004 C2 calcium-dependent membrane targeting

IPR000008 570 658 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001565	557	572	PR00399	Synaptotagmin
IPR001565	572	585	PR00399	Synaptotagmin
IPR000008	585	597	PR00360	C2 calcium-dependent membrane targeting
IPR000008	614	627	PR00360	C2 calcium-dependent membrane targeting
IPR001565	629	644	PR00399	Synaptotagmin
IPR000008	638	646	PR00360	C2 calcium-dependent membrane targeting
IPR001565	649	659	PR00399	Synaptotagmin
HMMPfam	IPR003315	4	276	PF02318	Rabphilin-3A effector
IPR000008	412	501	PF00168	C2 calcium-dependent membrane targeting
IPR000008	570	658	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	411	516	SM00239	C2 calcium-dependent membrane targeting
IPR000008	569	683	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR010911	47	163	PS50916	Rab-binding
IPR000306	95	151	PS50178	Zinc finger
IPR000008	410	501	PS50004	C2 calcium-dependent membrane targeting
IPR000008	570	658	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTTATCTTTCCCCATTAGTCC

Primer_r
: TGATTCCAGCGCCTACACCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTATCTTTCCCCATTAGTCC
Primer_r	: TGATTCCAGCGCCTACACCAG
PCR product length	: 128 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2097 bp
Genome contig ID	gi89161190f_111614094
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGATGTAGCCAAAAATAAAGTAGGAGCATCCAAG
Flanking genome sequence (206973 - 207022)	----+--------+--------+--------+--------+----* AAAACGAGTGGTCTGCAGTTTTCCTTTCTGGTTTCTGCGAAGTCCTCCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	111616764	111821065	23	99.6	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0985

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information