HUGE

Gene/Protein Characteristic Table for KIAA1004

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00712
Accession No. :	AB023221
Description :	JmjC domain-containing histone demethylation protein 1A.
HUGO Gene Name :	F-box and leucine-rich repeat protein 11 (FBXL11)
Clone Name :	hj01244 [Vector Info]
Flexi ORF Clone :	pF1KSDA1004
Source :	Human adult brain
Note :	We replaced hk10034, former representative clones for KIAA1004 with hj01244. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1296 bp

Genome contig ID gi51511727f_66543999
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCTCTCTAGGGCAGCAGAGAGCTTTTTGCACTTT
Flanking genome sequence
(236401 - 236450)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAAAGAAAGAAAGGTCGGAATTTCTTTTGGGTCAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 66643999 66780398 21 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1163 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2K7	100.0	JmjC domain-con...	Homo sapiens
XP_540823	99.5	similar to F-bo...	Canis lupus fam...
XP_001107511	99.6	similar to F-bo...	Macaca mulatta
XP_001172815	99.5	F-box and leuci...	Pan troglodytes
XP_865140	99.4	similar to F-bo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029034	1.7e-20	39.4	KIAA1111
AB014562	9.2e-16	33.0	KIAA0662

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013129 200 300 PF02373 Transcription factor jumonji

IPR002857 564 610 PF02008 Zinc finger

IPR001810 889 936 PF00646 Cyclin-like F-box

IPR001611 1121 1145 PF00560 Leucine-rich repeat

HMMSmart IPR003347 149 317 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

IPR001965 620 677 SM00249 Zinc finger

IPR006553 1001 1026 SM00367 Leucine-rich repeat

IPR006553 1064 1092 SM00367 Leucine-rich repeat

IPR006553 1096 1119 SM00367 Leucine-rich repeat

ProfileScan IPR003347 149 317 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

IPR002857 565 611 PS51058 Zinc finger

IPR001965 618 679 PS50016 Zinc finger

ScanRegExp IPR006058 578 586 PS00197 2Fe-2S ferredoxin

IPR001965 621 676 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	200	300	PF02373	Transcription factor jumonji
IPR002857	564	610	PF02008	Zinc finger
IPR001810	889	936	PF00646	Cyclin-like F-box
IPR001611	1121	1145	PF00560	Leucine-rich repeat
HMMSmart	IPR003347	149	317	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
IPR001965	620	677	SM00249	Zinc finger
IPR006553	1001	1026	SM00367	Leucine-rich repeat
IPR006553	1064	1092	SM00367	Leucine-rich repeat
IPR006553	1096	1119	SM00367	Leucine-rich repeat
ProfileScan	IPR003347	149	317	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase
IPR002857	565	611	PS51058	Zinc finger
IPR001965	618	679	PS50016	Zinc finger
ScanRegExp	IPR006058	578	586	PS00197	2Fe-2S ferredoxin
IPR001965	621	676	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGATCTTCGGTGGGCAGTAGG

Primer_r
: GCTTGCTGCGATTGTCCTGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1296 bp
Genome contig ID	gi51511727f_66543999
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCTCTCTAGGGCAGCAGAGAGCTTTTTGCACTTT
Flanking genome sequence (236401 - 236450)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAAAGAAAGAAAGGTCGGAATTTCTTTTGGGTCAATATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	66643999	66780398	21	100.0	Perfect prediction

Primer_f	: TGATCTTCGGTGGGCAGTAGG
Primer_r	: GCTTGCTGCGATTGTCCTGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1004

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information