HUGE

Gene/Protein Characteristic Table for KIAA1111

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01149
Accession No. :	AB029034
Description :	PHD finger protein 8.
HUGO Gene Name :	PHD finger protein 8 (PHF8)
Clone Name :	hj04651s1 [Vector Info]
Flexi ORF Clone :	pF1KA1111
Source :	Human adult brain
Note :	We replaced hj04651, former representative clones for KIAA1111 with hj04651s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4695 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1439 bp

Genome contig ID gi89161218r_53880877
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGGGAATTTAATAGCTACCATGCAGGCCACAGGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTGTGAGGCTTCTTTTGTCATCTTTGTATCTCCAGTTTGTCTTTCTT

Features of the protein sequence	Description

Length: 1084 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPP1	100.0	PHD finger prot...	Homo sapiens
AAH53861	100.0	PHD finger prot...	Homo sapiens
XP_549017	97.1	similar to PHD ...	Canis lupus fam...
XP_001914779	97.1	PHD finger prot...	Equus caballus
EDL86314	95.0	rCG38940 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014562	1.6e-63	46.2	KIAA0662
AB023221	5.8e-19	39.4	KIAA1004

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 67 116 PF00628 Zinc finger

IPR013129 294 394 PF02373 Transcription factor jumonji

HMMSmart IPR001965 67 114 SM00249 Zinc finger

IPR003347 255 411 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

ProfileScan IPR001965 65 116 PS50016 Zinc finger

IPR003347 255 411 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

ScanRegExp IPR013032 68 83 PS01186 EGF-like region

IPR001965 68 113 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	67	116	PF00628	Zinc finger
IPR013129	294	394	PF02373	Transcription factor jumonji
HMMSmart	IPR001965	67	114	SM00249	Zinc finger
IPR003347	255	411	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR001965	65	116	PS50016	Zinc finger
IPR003347	255	411	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase
ScanRegExp	IPR013032	68	83	PS01186	EGF-like region
IPR001965	68	113	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCCCCTGTCCTTCCTTCGTG

Primer_r
: GGGTAGTGCCAAATGGAGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCCCTGTCCTTCCTTCGTG
Primer_r	: GGGTAGTGCCAAATGGAGGTG
PCR product length	: 126 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1439 bp
Genome contig ID	gi89161218r_53880877
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGGGAATTTAATAGCTACCATGCAGGCCACAGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTGTGAGGCTTCTTTTGTCATCTTTGTATCTCCAGTTTGTCTTTCTT

Gene/Protein Characteristic Table for KIAA1111

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information