HUGE

Gene/Protein Characteristic Table for KIAA1005

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06681
Accession No. :	AB023222
Description :	Protein fantom.
HUGO Gene Name :	RPGRIP1-like (RPGRIP1L)
Clone Name :	hk10066 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4557 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1388 bp

Genome contig ID gi51511732r_52092101
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AATAGATTATGAGACAATTCATTACAGTTCAATAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGCAGCTATAATGCAAAAATGCAAGTATGAATATCTGCATAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 52192101 52279368 21 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1055 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001166735	99.1	hypothetical pr...	Pan troglodytes
XP_001086391	97.1	similar to reti...	Macaca mulatta
AAI36434	96.6	Unknown (protei...	Homo sapiens
NP_056087	92.9	RPGRIP1-like is...	Homo sapiens
BAG65540	94.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 612 701 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 435 532 SM00239 C2 calcium-dependent membrane targeting

IPR000008 611 716 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000008 610 701 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	612	701	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	435	532	SM00239	C2 calcium-dependent membrane targeting
IPR000008	611	716	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	610	701	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTAGACGTGAAAGGAGTATC

Primer_r
: GTGAGATTGGGTAAAAGCTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTTAGACGTGAAAGGAGTATC
Primer_r	: GTGAGATTGGGTAAAAGCTAG
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1388 bp
Genome contig ID	gi51511732r_52092101
PolyA signal sequence (None)	+--------+--------+----*----+---- AATAGATTATGAGACAATTCATTACAGTTCAATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAGCAGCTATAATGCAAAAATGCAAGTATGAATATCTGCATAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	52192101	52279368	21	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1005

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information