HUGE |
Gene/Protein Characteristic Table for KIAA1014 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00713 |
---|---|
Accession No. : | AB023231 |
Description : | Formin-binding protein 4. |
HUGO Gene Name : | formin binding protein 4 (FNBP4) |
Clone Name : | hk02388s2 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1014
![]() |
Source : | Human adult brain |
Note : | We replaced hk02388, former representative clones for KIAA1014 with hk02388s2. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4145 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 902 bp Genome contig ID gi51511727r_47594662 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
GTATATATGCACTAATAAAGCTTTTTTTATAATCCFlanking genome sequence
(99986 - 99937) ----+----*----+----*----+----*----+----*----+----*
TGATGGGTTATCCTTTTGCTCGTCAACTCCTGTTATTCTGATTATGTAAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 47694648 47745605 17 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1050 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAAGTGCTGAGGTCTAAGTGG | |
: TAGTGTGCGAAACGACCGAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |