HUGE

Gene/Protein Characteristic Table for KIAA1023

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05526
Accession No. :	AB028946
Description :	IQ domain-containing protein E.
HUGO Gene Name :	IQ motif containing E (IQCE)
Clone Name :	fh15455 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fg00777, former representative clones for KIAA1023 with fh15455. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 5581 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3580 bp

Genome contig ID gi89161213f_2475117
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TCATTATTGGCCTTTTAAATAAAAAGTTGTTTTGC
Flanking genome sequence
(145767 - 145816)
----+----*----+----*----+----*----+----*----+----*
AGTGTGCCTTGAGTGCCCCGTGAAGACTTCTCTTTAATGACCTCCAGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 2575117 2620882 21 98.9 Perfect prediction

Features of the protein sequence	Description

Length: 666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW87261	6.8e-211	99.7	IQ motif contai...	Homo sapiens
Q6IPM2	6.9e-211	99.7	IQ domain-conta...	Homo sapiens
AAH71858	4.9e-210	99.4	IQ motif contai...	Homo sapiens
XP_518939	3.5e-205	97.7	IQ motif contai...	Pan troglodytes
EAW87262	1.7e-198	99.7	IQ motif contai...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000048 514 534 PF00612 IQ calmodulin-binding region

IPR000048 573 593 PF00612 IQ calmodulin-binding region

HMMSmart IPR000048 512 534 SM00015 IQ calmodulin-binding region

IPR000048 571 593 SM00015 IQ calmodulin-binding region

ProfileScan IPR000048 513 542 PS50096 IQ calmodulin-binding region

IPR000048 572 601 PS50096 IQ calmodulin-binding region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	514	534	PF00612	IQ calmodulin-binding region
IPR000048	573	593	PF00612	IQ calmodulin-binding region
HMMSmart	IPR000048	512	534	SM00015	IQ calmodulin-binding region
IPR000048	571	593	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	513	542	PS50096	IQ calmodulin-binding region
IPR000048	572	601	PS50096	IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACTTAGCTTCTGTTTCTGC

Primer_r
: TCAGTTACACAGTCCATCAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3580 bp
Genome contig ID	gi89161213f_2475117
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCATTATTGGCCTTTTAAATAAAAAGTTGTTTTGC
Flanking genome sequence (145767 - 145816)	----+--------+--------+--------+--------+----* AGTGTGCCTTGAGTGCCCCGTGAAGACTTCTCTTTAATGACCTCCAGGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	2575117	2620882	21	98.9	Perfect prediction

Primer_f	: CCACTTAGCTTCTGTTTCTGC
Primer_r	: TCAGTTACACAGTCCATCAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1023

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information