HUGE

Gene/Protein Characteristic Table for KIAA1034

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00718
Accession No. :	AB028957
Description :	DNA-binding protein SATB2.
HUGO Gene Name :	SATB homeobox 2 (SATB2)
Clone Name :	fh00753 [Vector Info]
Flexi ORF Clone :	pF1KSDA1034
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4999 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2711 bp

Genome contig ID gi89161199r_199742469
PolyA signal sequence
(AATAAA,-10)
+----*----+----*----+----*----+----
TTTGGTTGTTAAAATAAACGCATTCAATAAATATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTGTTTGTCAGTTATTTTACTGGGCATTATCTGCTTTCCCACTTAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 199842469 200033446 11 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 761 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92613	100.0	SATB family mem...	Homo sapiens
XP_516012	100.0	SATB family mem...	Pan troglodytes
Q9UPW6	100.0	DNA-binding pro...	Homo sapiens
BAG51771	99.9	unnamed protein...	Homo sapiens
XP_614966	99.5	similar to SATB...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003350 383 465 PF02376 Homeodomain protein CUT

IPR003350 501 588 PF02376 Homeodomain protein CUT

IPR001356 643 700 PF00046 Homeobox

HMMSmart IPR001356 642 705 SM00389 Homeobox

ProfileScan IPR003350 378 465 PS51042 Homeodomain protein CUT

IPR003350 501 588 PS51042 Homeodomain protein CUT

IPR001356 640 701 PS50071 Homeobox

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003350	383	465	PF02376	Homeodomain protein CUT
IPR003350	501	588	PF02376	Homeodomain protein CUT
IPR001356	643	700	PF00046	Homeobox
HMMSmart	IPR001356	642	705	SM00389	Homeobox
ProfileScan	IPR003350	378	465	PS51042	Homeodomain protein CUT
IPR003350	501	588	PS51042	Homeodomain protein CUT
IPR001356	640	701	PS50071	Homeobox

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGGTTGCTGCTTCCTGATCT

Primer_r
: AAGATACCAAATGCGGATGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2711 bp
Genome contig ID	gi89161199r_199742469
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- TTTGGTTGTTAAAATAAACGCATTCAATAAATATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTGTTTGTCAGTTATTTTACTGGGCATTATCTGCTTTCCCACTTAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	199842469	200033446	11	99.4	Perfect prediction

Primer_f	: ATGGTTGCTGCTTCCTGATCT
Primer_r	: AAGATACCAAATGCGGATGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1034

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information