HUGE

Gene/Protein Characteristic Table for KIAA1037

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07362
Accession No. :	AB028960
Description :	WD and tetratricopeptide repeats protein 1.
HUGO Gene Name :	WD and tetratricopeptide repeats 1 (WDTC1)
Clone Name :	fh02134 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5091 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3623 bp

Genome contig ID gi89161185f_27386787
PolyA signal sequence
(AATATA,-21)
+----*----+----*----+----*----+----
TTACATTGTGACCCAATATACACATGATTACTTGT
Flanking genome sequence
(120855 - 120904)
----+----*----+----*----+----*----+----*----+----*
AGATATGTGTGTGTGTATATATATATAAAAAAAATGAACAAAAGTTTTAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 27486787 27507640 10 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 488 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX07772	0	100.0	WD and tetratri...	Homo sapiens
EAX07769	3.9e-197	97.8	WD and tetratri...	Homo sapiens
XP_001147927	1.3e-196	100.0	WD and tetratri...	Pan troglodytes
Q8N5D0	1.5e-196	100.0	WD and tetratri...	Homo sapiens
BAA91868	1.6e-196	97.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018262	8e-07	28.7	KIAA0719

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 15 54 PF00400 WD40 repeat

IPR001440 253 286 PF00515 Tetratricopeptide TPR_1

IPR001440 287 323 PF00515 Tetratricopeptide TPR_1

HMMSmart IPR013026 253 286 SM00028 Tetratricopeptide region

IPR013026 287 323 SM00028 Tetratricopeptide region

IPR013026 324 357 SM00028 Tetratricopeptide region

ProfileScan IPR001680 1 63 PS50294 WD40 repeat

IPR013026 253 357 PS50293 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	15	54	PF00400	WD40 repeat
IPR001440	253	286	PF00515	Tetratricopeptide TPR_1
IPR001440	287	323	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	253	286	SM00028	Tetratricopeptide region
IPR013026	287	323	SM00028	Tetratricopeptide region
IPR013026	324	357	SM00028	Tetratricopeptide region
ProfileScan	IPR001680	1	63	PS50294	WD40 repeat
IPR013026	253	357	PS50293	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCCTCTAAATGTCAGTGGTG

Primer_r
: ATATAGCCCTGGTCACTGTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGAAGACAAGTGGAGGGTGAG
Primer_r	: GAGAAAGGTCACGGAGAAGAG
PCR product length	: 231 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3623 bp
Genome contig ID	gi89161185f_27386787
PolyA signal sequence (AATATA,-21)	+--------+--------+----*----+---- TTACATTGTGACCCAATATACACATGATTACTTGT
Flanking genome sequence (120855 - 120904)	----+--------+--------+--------+--------+----* AGATATGTGTGTGTGTATATATATATAAAAAAAATGAACAAAAGTTTTAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	27486787	27507640	10	99.5	Perfect prediction

Primer_f	: GCCCTCTAAATGTCAGTGGTG
Primer_r	: ATATAGCCCTGGTCACTGTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1037

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information