HUGE

Gene/Protein Characteristic Table for KIAA1038

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05398
Accession No. :	AB028961
Description :	HBS1-like protein.
HUGO Gene Name :	HBS1-like (S. cerevisiae) (HBS1L)
Clone Name :	fh02273 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5662 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4171 bp

Genome contig ID gi89161210r_135223941
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATGAATGGAATTAGTGAAACTATTCATATCAATGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGCAAAGAAACTAAGTCTGTACAGCAAAAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 135323941 135360462 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 496 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH12760	6.9e-203	100.0	unnamed protein...	Homo sapiens
BAH12101	8.2e-203	100.0	unnamed protein...	Homo sapiens
BAF85345	8.6e-203	100.0	unnamed protein...	Homo sapiens
Q9Y450	8.6e-203	100.0	HBS1-like prote...	Homo sapiens
BAG51281	2.9e-202	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000795 74 87 PR00315 Protein synthesis factor

IPR000795 133 141 PR00315 Protein synthesis factor

IPR000795 153 163 PR00315 Protein synthesis factor

IPR000795 169 180 PR00315 Protein synthesis factor

IPR000795 213 222 PR00315 Protein synthesis factor

HMMPfam IPR000795 70 293 PF00009 Protein synthesis factor

IPR004161 314 381 PF03144 Translation elongation factor EFTu/EF1A

IPR004160 387 495 PF03143 Translation elongation factor EFTu/EF1A

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000795	74	87	PR00315	Protein synthesis factor
IPR000795	133	141	PR00315	Protein synthesis factor
IPR000795	153	163	PR00315	Protein synthesis factor
IPR000795	169	180	PR00315	Protein synthesis factor
IPR000795	213	222	PR00315	Protein synthesis factor
HMMPfam	IPR000795	70	293	PF00009	Protein synthesis factor
IPR004161	314	381	PF03144	Translation elongation factor EFTu/EF1A
IPR004160	387	495	PF03143	Translation elongation factor EFTu/EF1A

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATCCACTGTGTAAGAAGACTG

Primer_r
: GGTAGGAAATCAGAGCATAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4171 bp
Genome contig ID	gi89161210r_135223941
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGAATGGAATTAGTGAAACTATTCATATCAATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGCAAAGAAACTAAGTCTGTACAGCAAAAGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	135323941	135360462	13	99.3	Perfect prediction

Primer_f	: ATCCACTGTGTAAGAAGACTG
Primer_r	: GGTAGGAAATCAGAGCATAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1038

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information