HUGE |
Gene/Protein Characteristic Table for KIAA1042 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01145 |
---|---|
Accession No. : | AB028965 |
Description : | Trafficking kinesin-binding protein 1. |
HUGO Gene Name : | trafficking protein, kinesin binding 1 (TRAK1) |
Clone Name : | fh02877 [Vector Info] |
Flexi ORF Clone : | pF1KA1042 |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5109 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2031 bp Genome contig ID gi89161205f_42007750 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CTAATGAGTATCAATAAAATAAGTTCAAATGATGGFlanking genome sequence
(234516 - 234565) ----+----*----+----*----+----*----+----*----+----*
AAACCACACTGGTATTCTGATTTGTATTTTGTTTTTATCTTTTCATCAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 42107750 42242264 16 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1019 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTGGCAATGATGAGTGGCTTC | |
: TCCCTGCTGTTGTATGTGTGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |