HUGE |
Gene/Protein Characteristic Table for KIAA1044 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00720 |
---|---|
Accession No. : | AB028967 |
Description : | Potassium voltage-gated channel subfamily D member 2. |
HUGO Gene Name : | potassium voltage-gated channel, Shal-related subfamily, member 2 (KCND2) |
Clone Name : | fh03989 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1044 |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5333 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2475 bp Genome contig ID gi89161213f_119600958 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
TACTTAAATAAAACATGTGCATGCTTGAACAGGACFlanking genome sequence
(576667 - 576716) ----+----*----+----*----+----*----+----*----+----*
AAAATGTTGACTGTTGCCCTATTTTCTTAGATTTCATTCCTTTCCCAAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 119700958 120177623 6 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 646 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCTAGATACTGTTACAACTGC | |
: CTACGAATGTGGCTCTTACCG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: CCTAGATACTGTTACAACTGC | |
: CTACGAATGTGGCTCTTACCG | |
: 117 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |