HUGE

Gene/Protein Characteristic Table for KIAA1045

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00721
Accession No. :	AB028968
Description :
HUGO Gene Name :
Clone Name :	hh00656 [Vector Info]
Flexi ORF Clone :	pF1KSDA1045
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5712 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4427 bp

Genome contig ID gi89161216f_34848321
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACAGTGGAAATCATAATAAAGCGATTGCGATGCTC
Flanking genome sequence
(124222 - 124271)
----+----*----+----*----+----*----+----*----+----*
TGTCGGCTTCCTGTTTCTTGTTGTTTGGGGAACCTGCCATTTCTGTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 34948321 34972541 8 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 427 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_520427	4.5e-161	99.2	similar to RP11...	Pan troglodytes
CAI29683	1.3e-160	97.3	hypothetical pr...	Pongo abelii
CAH93249	5.4e-159	98.0	hypothetical pr...	Pongo abelii
BAE90573	5.4e-159	97.8	unnamed protein...	Macaca fascicularis
BAE90222	1.1e-150	97.9	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR001965 160 215 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001965	160	215	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCAGGTGCAGAAGGTGAGTC

Primer_r
: GCACTACTCTCTTCCTGGACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTCAAGATTAGCCTCCTGCC
Primer_r	: GTGTTACTCAAGTGTTCTCAG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4427 bp
Genome contig ID	gi89161216f_34848321
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACAGTGGAAATCATAATAAAGCGATTGCGATGCTC
Flanking genome sequence (124222 - 124271)	----+--------+--------+--------+--------+----* TGTCGGCTTCCTGTTTCTTGTTGTTTGGGGAACCTGCCATTTCTGTGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	34948321	34972541	8	99.2	Perfect prediction

Primer_f	: AGCAGGTGCAGAAGGTGAGTC
Primer_r	: GCACTACTCTCTTCCTGGACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1045

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information