HUGE

Gene/Protein Characteristic Table for KIAA1053

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06724
Accession No. :	AB028976
Description :	Sterile alpha motif domain-containing protein 4A.
HUGO Gene Name :	sterile alpha motif domain containing 4A (SAMD4A)
Clone Name :	hh05049 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5896 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4367 bp

Genome contig ID gi51511730f_54138698
PolyA signal sequence
(AATACA,-18)
+----*----+----*----+----*----+----
AGTGAAGGGAAATGATTAATACAAGGTTTTGTAAC
Flanking genome sequence
(191083 - 191132)
----+----*----+----*----+----*----+----*----+----*
ACTGGTGTGTCTTTTTCTTTTTTTCAACATACATGATTGAATAGAAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 54238698 54329779 10 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 508 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPU9	5e-195	100.0	Sterile alpha m...	Homo sapiens
AAI21175	5.7e-195	100.0	SAMD4A protein ...	Homo sapiens
XP_001161253	2.6e-194	99.4	sterile alpha m...	Pan troglodytes
BAB64436	9.5e-193	98.6	hypothetical pr...	Macaca fascicularis
XP_613436	1.3e-189	97.0	sterile alpha m...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001660 111 171 PF00536 Sterile alpha motif SAM

HMMSmart IPR001660 110 173 SM00454 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	111	171	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	110	173	SM00454	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCGTTTGAAGAGACACTGAGG

Primer_r
: GAATAACATCTACAACCTTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4367 bp
Genome contig ID	gi51511730f_54138698
PolyA signal sequence (AATACA,-18)	+--------+--------+----*----+---- AGTGAAGGGAAATGATTAATACAAGGTTTTGTAAC
Flanking genome sequence (191083 - 191132)	----+--------+--------+--------+--------+----* ACTGGTGTGTCTTTTTCTTTTTTTCAACATACATGATTGAATAGAAAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	54238698	54329779	10	99.3	Perfect prediction

Primer_f	: TCGTTTGAAGAGACACTGAGG
Primer_r	: GAATAACATCTACAACCTTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1053

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information