| HUGE |
Gene/Protein Characteristic Table for KIAA1056 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00725 |
|---|---|
| Accession No. : | AB028979 |
| Description : | Zinc finger protein 409. |
| HUGO Gene Name : | zinc finger protein 409 (ZNF409) |
| Clone Name : | hh11792 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1056
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5428 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2483 bp Genome contig ID gi51511730r_22967258 PolyA signal sequence
(None)
CACTCCGGCCTGGGTGACAGAGCCAGACTCCATCTFlanking genome sequence
(99717 - 99668)
AAAAAAAAAAAAAAAAAAAAAAAAGGAGTGGGGGCGGGCCAGTGCTGCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 r 23066975 23090698 4 99.2 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 870 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : TCACAGAGAAGACACGACAGG | |
| : CCTCAACTCTCCAGCTAACAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 14 |
| : GeneBridge 4 | |
| : TCACAGAGAAGACACGACAGG | |
| : CCTCAACTCTCCAGCTAACAG | |
| : 101 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
