HUGE |
Gene/Protein Characteristic Table for KIAA1056 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00725 |
---|---|
Accession No. : | AB028979 |
Description : | Zinc finger protein 409. |
HUGO Gene Name : | zinc finger protein 409 (ZNF409) |
Clone Name : | hh11792 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1056
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5428 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2483 bp Genome contig ID gi51511730r_22967258 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CACTCCGGCCTGGGTGACAGAGCCAGACTCCATCTFlanking genome sequence
(99717 - 99668) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAGGAGTGGGGGCGGGCCAGTGCTGCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 r 23066975 23090698 4 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 870 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 461 | 484 | PF00096 | Zinc finger |
IPR007087 | 516 | 540 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 245 | 267 | SM00355 | Zinc finger |
IPR015880 | 461 | 484 | SM00355 | Zinc finger | |
IPR015880 | 516 | 540 | SM00355 | Zinc finger | |
IPR015880 | 577 | 601 | SM00355 | Zinc finger | |
IPR015880 | 766 | 790 | SM00355 | Zinc finger | |
IPR015880 | 829 | 853 | SM00355 | Zinc finger | |
ScanRegExp | IPR007087 | 247 | 267 | PS00028 | Zinc finger |
IPR007087 | 463 | 484 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCACAGAGAAGACACGACAGG | |
: CCTCAACTCTCCAGCTAACAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: TCACAGAGAAGACACGACAGG | |
: CCTCAACTCTCCAGCTAACAG | |
: 101 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |