HUGE |
Gene/Protein Characteristic Table for KIAA1059 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00727 |
---|---|
Accession No. : | AB028982 |
Description : | VPS10 domain-containing receptor SorCS3 precursor. |
HUGO Gene Name : | sortilin-related VPS10 domain containing receptor 3 (SORCS3) |
Clone Name : | hh12158 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1059
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5757 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1861 bp Genome contig ID gi89161187f_106290849 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TGAAATTGTTGAAAATAAATGTATTTTTGTACATCFlanking genome sequence
(724136 - 724185) ----+----*----+----*----+----*----+----*----+----*
AAAGCTACATACGTGGCTGAGTTTTCTCTTTGGGGAGTTTTCTTTATCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 106390849 107014983 26 100.0 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1297 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTTCCCATTCTTCTTTGTGAG | |
: ATTGTCTGCCCCATTTAACCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: GTTCCCATTCTTCTTTGTGAG | |
: ATTGTCTGCCCCATTTAACCC | |
: 132 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |