HUGE

Gene/Protein Characteristic Table for KIAA1077

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07023
Accession No. :	AB029000
Description :	Extracellular sulfatase Sulf-1 precursor.
HUGO Gene Name :	sulfatase 1 (SULF1)
Clone Name :	hj06803 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4834 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2377 bp

Genome contig ID gi51511724f_70550758
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GCAATATTTCTTCAAATAAAAGGTGTTTAAACTTT
Flanking genome sequence
(184945 - 184994)
----+----*----+----*----+----*----+----*----+----*
TTTCTGTTTCAGAGAAATGAACTTAACCAAGTTTTTGTGGTACACCCATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 70650758 70735701 18 100.0 Terminal No-hit

Features of the protein sequence	Description

Length: 818 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IWU6	100.0	Extracellular s...	Homo sapiens
AAO33315	100.0	sulfatase SULF1...	Homo sapiens
CAE11871	99.9	hypothetical pr...	Homo sapiens
EAW86954	99.0	sulfatase 1, is...	Homo sapiens
NP_001041580	94.5	sulfatase 1 [Ca...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033073	1.3e-115	65.8	KIAA1247

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000917 20 759 PF00884 Sulphatase

ScanRegExp IPR000917 32 44 PS00523 Sulphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000917	20	759	PF00884	Sulphatase
ScanRegExp	IPR000917	32	44	PS00523	Sulphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTCCACAATTTCAACATACC

Primer_r
: GAATAGGAGGGTACTGATGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2377 bp
Genome contig ID	gi51511724f_70550758
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCAATATTTCTTCAAATAAAAGGTGTTTAAACTTT
Flanking genome sequence (184945 - 184994)	----+--------+--------+--------+--------+----* TTTCTGTTTCAGAGAAATGAACTTAACCAAGTTTTTGTGGTACACCCATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	70650758	70735701	18	100.0	Terminal No-hit

Primer_f	: GCTCCACAATTTCAACATACC
Primer_r	: GAATAGGAGGGTACTGATGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1077

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information