HUGE |
Gene/Protein Characteristic Table for KIAA1077 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07023 |
---|---|
Accession No. : | AB029000 |
Description : | Extracellular sulfatase Sulf-1 precursor. |
HUGO Gene Name : | sulfatase 1 (SULF1) |
Clone Name : | hj06803 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4834 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2377 bp Genome contig ID gi51511724f_70550758 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
GCAATATTTCTTCAAATAAAAGGTGTTTAAACTTTFlanking genome sequence
(184945 - 184994) ----+----*----+----*----+----*----+----*----+----*
TTTCTGTTTCAGAGAAATGAACTTAACCAAGTTTTTGTGGTACACCCATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 f 70650758 70735701 18 100.0 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 818 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000917 | 20 | 759 | PF00884 | Sulphatase |
ScanRegExp | IPR000917 | 32 | 44 | PS00523 | Sulphatase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCTCCACAATTTCAACATACC | |
: GAATAGGAGGGTACTGATGAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 8 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |