HUGE

Gene/Protein Characteristic Table for KIAA1247

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00780
Accession No. :	AB033073
Description :	Extracellular sulfatase Sulf-2 precursor.
HUGO Gene Name :	sulfatase 2 (SULF2)
Clone Name :	pj01452 [Vector Info]
Flexi ORF Clone :	pF1KSDA1247
Source :	Human brain (hippocampus)
Note :	We replaced hh03128a, former representative clones for KIAA1247 with pj01452. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 4397 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1454 bp

Genome contig ID gi51511747r_45619063
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTAACCTCCTTTACCCTTAACCCAACAGGGATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAACTCTTTAGGCTCCAATTTTAAATAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 45719063 45848215 21 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 885 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001106412	98.5	similar to sulf...	Macaca mulatta
BAG10010	100.0	extracellular s...	synthetic construct
Q8IWU5	99.9	Extracellular s...	Homo sapiens
AAQ88826	99.5	GPPS559 [Homo s...	Homo sapiens
EAW75691	97.8	sulfatase 2, is...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029000	1.4e-140	65.8	KIAA1077
AB023218	0.00024	21.4	KIAA1001

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000917 57 465 PF00884 Sulphatase

ScanRegExp IPR000917 101 113 PS00523 Sulphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000917	57	465	PF00884	Sulphatase
ScanRegExp	IPR000917	101	113	PS00523	Sulphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAAGAAACAACAGAGGTGGAC

Primer_r
: CTGAAGTTATCTCTGCTCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1454 bp
Genome contig ID	gi51511747r_45619063
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAACCTCCTTTACCCTTAACCCAACAGGGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAACTCTTTAGGCTCCAATTTTAAATAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	45719063	45848215	21	99.5	Perfect prediction

Primer_f	: TAAGAAACAACAGAGGTGGAC
Primer_r	: CTGAAGTTATCTCTGCTCCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1247

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information