HUGE |
Gene/Protein Characteristic Table for KIAA1001 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01621 |
---|---|
Accession No. : | AB023218 |
Description : | Arylsulfatase G precursor. |
HUGO Gene Name : | arylsulfatase G (ARSG) |
Clone Name : | hk09652 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1001
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4304 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Content-type: text/html ¥¨¥é¡¼¡ª
hk09652 ¤Î¾ðÊ󤬥ǡ¼¥¿¥Ù¡¼¥¹¤Ë¤¢¤ê¤Þ¤»¤ó¤Ç¤·¤¿¡£
¤â¤É¤ë
Features of the protein sequence |
Description | |
---|---|---|
Length: 551 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000917 | 60 | 419 | PF00884 | Sulphatase |
ScanRegExp | IPR000917 | 108 | 120 | PS00523 | Sulphatase |
IPR000917 | 155 | 165 | PS00149 | Sulphatase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 29 | WLFLKVLLAGVSFSGFLYPLVDF | 51 | PRIMARY | 23 |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAAAGAGGTGGTGCGGAGTAC | |
: TGACAGCGGCAGGCAATTTGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |