HUGE

Gene/Protein Characteristic Table for KIAA1078

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04430
Accession No. :	AB029001
Description :	calmodulin regulated spectrin-associated protein 1-like 1.
HUGO Gene Name :	calmodulin regulated spectrin-associated protein 1-like 1 (CAMSAP1L1)
Clone Name :	fg04938 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hj06941, former representative clones for KIAA1078 with fg04938. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6740 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2642 bp

Genome contig ID gi89161185f_198943126
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TTTTTCCCCTTTCATTTGAATAAAAGCATGGCACC
Flanking genome sequence
(153328 - 153377)
----+----*----+----*----+----*----+----*----+----*
AAATGACTCCTTTTCTGTTTCTTGAATAAAATGTAGTTTTTGGTAAAATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 198996823 199096452 17 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1365 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI17077	99.9	calmodulin regu...	Homo sapiens
Q08AD1	99.9	Calmodulin-regu...	Homo sapiens
XP_001144062	99.3	hypothetical pr...	Pan troglodytes
XP_001143995	99.3	hypothetical pr...	Pan troglodytes
EAW91321	99.1	calmodulin regu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040976	2.2e-19	35.4	KIAA1543

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014797 1224 1353 PF08683 Protein of unknown function DUF1781

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014797	1224	1353	PF08683	Protein of unknown function DUF1781

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATACAGGACCAAAGCTCTAC

Primer_r
: TCTGAACTGGCATCCTGAATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2642 bp
Genome contig ID	gi89161185f_198943126
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TTTTTCCCCTTTCATTTGAATAAAAGCATGGCACC
Flanking genome sequence (153328 - 153377)	----+--------+--------+--------+--------+----* AAATGACTCCTTTTCTGTTTCTTGAATAAAATGTAGTTTTTGGTAAAATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	198996823	199096452	17	100.0	Perfect prediction

Primer_f	: TATACAGGACCAAAGCTCTAC
Primer_r	: TCTGAACTGGCATCCTGAATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1078

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information