HUGE

Gene/Protein Characteristic Table for KIAA1543

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05673
Accession No. :	AB040976
Description :
HUGO Gene Name :
Clone Name :	hh05613a [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2800 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 46 bp

Genome contig ID gi42406306f_7481765
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CGGTCCACGGGCCGGGCCCTGTGTGCTGCGGCCGC
Flanking genome sequence
(107226 - 107275)
----+----*----+----*----+----*----+----*----+----*
CATCCCCTGGAGGACAGTCAGTCGGTATTCCTGGGTCCTGTCTGTCCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 7581765 7588989 10 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW69026	100.0	hCG2004001, iso...	Homo sapiens
EAW69025	100.0	hCG2004001, iso...	Homo sapiens
XP_001090322	97.6	hypothetical pr...	Macaca mulatta
XP_001090205	97.6	hypothetical pr...	Macaca mulatta
CAD38783	100.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029001	1.2e-15	35.4	KIAA1078

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014797 776 905 PF08683 Protein of unknown function DUF1781

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014797	776	905	PF08683	Protein of unknown function DUF1781

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTCAGGTCTCATGTCCCCAAG

Primer_r
: AAGAGGATCAGGAAGTGGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	46 bp
Genome contig ID	gi42406306f_7481765
PolyA signal sequence (None)	+--------+--------+----*----+---- CGGTCCACGGGCCGGGCCCTGTGTGCTGCGGCCGC
Flanking genome sequence (107226 - 107275)	----+--------+--------+--------+--------+----* CATCCCCTGGAGGACAGTCAGTCGGTATTCCTGGGTCCTGTCTGTCCCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	7581765	7588989	10	100.0	Perfect prediction

Primer_f	: GTCAGGTCTCATGTCCCCAAG
Primer_r	: AAGAGGATCAGGAAGTGGTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1543

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information