HUGE |
Gene/Protein Characteristic Table for KIAA1543 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05673 |
---|---|
Accession No. : | AB040976 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hh05613a [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2800 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 46 bp Genome contig ID gi42406306f_7481765 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CGGTCCACGGGCCGGGCCCTGTGTGCTGCGGCCGCFlanking genome sequence
(107226 - 107275) ----+----*----+----*----+----*----+----*----+----*
CATCCCCTGGAGGACAGTCAGTCGGTATTCCTGGGTCCTGTCTGTCCCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 7581765 7588989 10 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 917 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTCAGGTCTCATGTCCCCAAG | |
: AAGAGGATCAGGAAGTGGTTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |