HUGE

Gene/Protein Characteristic Table for KIAA1080

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05288
Accession No. :	AB029003
Description :	ADP-ribosylation factor-binding protein GGA2.
HUGO Gene Name :	golgi associated, gamma adaptin ear containing, ARF binding protein 2 (GGA2)
Clone Name :	hj07082 [Vector Info]
Flexi ORF Clone :	pF1KA1080
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4791 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3236 bp

Genome contig ID gi51511732r_23283146
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTCACCACAGCCACAATAAAGTCCTTTCAAGCCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GATAATGCCATGTTTTGTCCTAACCTTTTGCTGCAGTTAATTACTCTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 23383146 23412245 15 98.9 Perfect prediction

Features of the protein sequence	Description

Length: 517 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF35394	1.3e-192	99.8	gamma-adaptin r...	Homo sapiens
AAF05708	5e-192	99.6	ADP-ribosylatio...	Homo sapiens
XP_001162172	2.8e-185	96.5	ADP-ribosylatio...	Pan troglodytes
XP_001162100	2.9e-185	96.5	ADP-ribosylatio...	Pan troglodytes
XP_001162281	4.8e-185	96.3	ADP-ribosylatio...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63876	1.4e-26	37.1	KIAA0154

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002014 1 63 PD003686 VHS

IPR008153 375 509 PD021457 Clathrin adaptor

HMMPfam IPR002014 1 63 PF00790 VHS

IPR004152 127 228 PF03127 GAT

IPR008152 385 509 PF02883 Clathrin adaptor

HMMSmart IPR008152 385 509 SM00809 Clathrin adaptor

ProfileScan IPR002014 1 67 PS50179 VHS

IPR004152 92 219 PS50909 GAT

IPR008153 388 509 PS50180 Clathrin adaptor

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002014	1	63	PD003686	VHS
IPR008153	375	509	PD021457	Clathrin adaptor
HMMPfam	IPR002014	1	63	PF00790	VHS
IPR004152	127	228	PF03127	GAT
IPR008152	385	509	PF02883	Clathrin adaptor
HMMSmart	IPR008152	385	509	SM00809	Clathrin adaptor
ProfileScan	IPR002014	1	67	PS50179	VHS
IPR004152	92	219	PS50909	GAT
IPR008153	388	509	PS50180	Clathrin adaptor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTGTCCCAATTCTGAGTAAC

Primer_r
: CAGATGATACCAGAAGGGCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3236 bp
Genome contig ID	gi51511732r_23283146
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTCACCACAGCCACAATAAAGTCCTTTCAAGCCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GATAATGCCATGTTTTGTCCTAACCTTTTGCTGCAGTTAATTACTCTTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	23383146	23412245	15	98.9	Perfect prediction

Primer_f	: TCTGTCCCAATTCTGAGTAAC
Primer_r	: CAGATGATACCAGAAGGGCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1080

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information