| HUGE |
Gene/Protein Characteristic Table for KIAA0154 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00433 |
|---|---|
| Accession No. : | D63876 |
| Description : | ADP-ribosylation factor-binding protein GGA3. |
| HUGO Gene Name : | golgi associated, gamma adaptin ear containing, ARF binding protein 3 (GGA3) |
| Clone Name : | ha03131 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0154
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3760 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1679 bp Genome contig ID gi51511734r_70644290 PolyA signal sequence
(AATAAA,-20)
TTTTGCTGCATGTTAAATAAAACCATTTTCACTGTFlanking genome sequence
(100000 - 99951)
ACTTGGAATCTTCCTAGTATAGACGCCATTCACCCTGATGGAGGAAAAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 70744290 70769271 16 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 692 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : Stanford G3 | |
| : TGTACTCCAAGCCTCCGTCAC | |
| : TCCTTTCCCCAGAGATGTCCG | |
| : 112 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
