HUGE

Gene/Protein Characteristic Table for KIAA1086

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05633
Accession No. :	AB029009
Description :
HUGO Gene Name :
Clone Name :	hj08218 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4635 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1925 bp

Genome contig ID gi42406306r_3655022
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTGGGAGGCAGGGGGAATAAAGGAAATCATTTGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTTGTGTGAGCCGTGCCGTCCTTCCTGCGGGGTGCAGGTGACCCCAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 3755022 3785924 18 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 902 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPR6	0	100.0	Zinc finger RNA...	Homo sapiens
NP_055989	0	99.9	zinc finger RNA...	Homo sapiens
EAW69282	0	99.8	hCG23534, isofo...	Homo sapiens
EAW69283	0	99.8	hCG23534, isofo...	Homo sapiens
NP_001030067	6.8e-109	52.7	zinc finger RNA...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006561 621 867 PF07528 DZF

HMMSmart IPR003604 231 265 SM00451 Zinc finger

IPR015880 234 258 SM00355 Zinc finger

IPR003604 279 313 SM00451 Zinc finger

IPR015880 282 306 SM00355 Zinc finger

IPR003604 428 462 SM00451 Zinc finger

IPR015880 431 455 SM00355 Zinc finger

IPR006561 615 867 SM00572 DZF

ScanRegExp IPR007087 236 258 PS00028 Zinc finger

IPR007087 284 306 PS00028 Zinc finger

IPR007087 433 455 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006561	621	867	PF07528	DZF
HMMSmart	IPR003604	231	265	SM00451	Zinc finger
IPR015880	234	258	SM00355	Zinc finger
IPR003604	279	313	SM00451	Zinc finger
IPR015880	282	306	SM00355	Zinc finger
IPR003604	428	462	SM00451	Zinc finger
IPR015880	431	455	SM00355	Zinc finger
IPR006561	615	867	SM00572	DZF
ScanRegExp	IPR007087	236	258	PS00028	Zinc finger
IPR007087	284	306	PS00028	Zinc finger
IPR007087	433	455	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAACCTGTTCAAACCTTCCGC

Primer_r
: TTCAGACAGAGCCACATGCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAACCTGTTCAAACCTTCCGC
Primer_r	: TTCAGACAGAGCCACATGCAG
PCR product length	: 164 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1925 bp
Genome contig ID	gi42406306r_3655022
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGGGAGGCAGGGGGAATAAAGGAAATCATTTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTTGTGTGAGCCGTGCCGTCCTTCCTGCGGGGTGCAGGTGACCCCAAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	3755022	3785924	18	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1086

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information