HUGE |
Gene/Protein Characteristic Table for KIAA1088 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00735 |
---|---|
Accession No. : | AB029011 |
Description : | Tumor necrosis factor receptor superfamily member 6B precursor. |
HUGO Gene Name : | regulator of telomere elongation helicase 1 (RTEL1) |
Clone Name : | hk02589s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1088 |
Source : | Human adult brain |
Note : | We replaced hk02589, former representative clones for KIAA1088 with hk02589s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4945 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 742 bp Genome contig ID gi51511747f_61661200 PolyA signal sequence
(TATAAA,-34) +----*----+----*----+----*----+----
TTATAAAGCTTTTTCATAAAACTGGTTGTAGTTGCFlanking genome sequence
(139297 - 139346) ----+----*----+----*----+----*----+----*----+----*
ACAGCTACTGGGAGGGCAGCCGGGGACACCTGAGCCGCCCGCTGTGCCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 61761200 61800495 37 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1400 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTCAATGTGCCAGGCTCTTCC | |
: GGAAAGCCACAAAGTCGATGA | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 4 |
: GeneBridge 4 | |
: AGGGGACAGTCGTGATCTTTG | |
: CAGGTCATGGGGAGTCAGGTC | |
: 89 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |