HUGE |
Gene/Protein Characteristic Table for KIAA1095 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00740 |
---|---|
Accession No. : | AB029018 |
Description : | PDZ domain-containing RING finger protein 3. |
HUGO Gene Name : | PDZ domain containing ring finger 3 (PDZRN3) |
Clone Name : | hk06736 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1095
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4161 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 864 bp Genome contig ID gi89161205r_73414342 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CAGTAAAATGAAGTTAAAATAAATTATTATTTTCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTGATATGTTTTGATGTGATTCCTCATTTTGCAGTGGTGCCTATAAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 73514342 73756762 10 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1098 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCGCGAGTTCATGATGCAGAG | |
: TTGTATACTCTAGTGCCGTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |