HUGE |
Gene/Protein Characteristic Table for KIAA0147 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00428 |
---|---|
Accession No. : | D63481 |
Description : | Protein LAP4. |
HUGO Gene Name : | scribbled homolog (Drosophila) (SCRIB) |
Clone Name : | ha01022s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0147
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha01022, former representative clones for KIAA0147 with ha01022s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5132 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 237 bp Genome contig ID gi51511724r_144845084 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTGTGGTTTAAGGAGAATAAAGTTGACTACATTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACCTCCCGTCTGCCTGTCCATCCCCCACCCACTAGCACAGACCCTTCCTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 r 144945084 144969532 36 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1630 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 8 |
: Genebridge 4 | |
: AAGTTCTGCAAGGCTCTGGAG | |
: GGCAGCACTTCCAGATCGTTG | |
: 148 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |