HUGE

Gene/Protein Characteristic Table for KIAA0862

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00664
Accession No. :	AB020669
Description :	Leucine-rich repeat protein SHOC-2.
HUGO Gene Name :	soc-2 suppressor of clear homolog (C. elegans) (SHOC2)
Clone Name :	hk06532 [Vector Info]
Flexi ORF Clone :	pF1KSDA0862
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3872 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1846 bp

Genome contig ID gi89161187f_112569363
PolyA signal sequence
(TATAAA,-33)
+----*----+----*----+----*----+----
TTTATAAAAGGAATTTGTTTATTACAGCTCTACCT
Flanking genome sequence
(194051 - 194100)
----+----*----+----*----+----*----+----*----+----*
AGAGCTTGTGTGTTTGTGTGGTTTTTTAAATCTCGTATCCAGGTGTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 112669363 112763412 9 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 584 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09878	1.3e-216	100.0	leucine-rich re...	synthetic construct
Q9UQ13	2.3e-216	99.8	Leucine-rich re...	Homo sapiens
XP_001087610	4.1e-216	99.7	soc-2 suppresso...	Macaca mulatta
BAF85522	4.7e-216	99.7	unnamed protein...	Homo sapiens
A6QLV3	4.7e-216	99.7	Leucine-rich re...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63481	9.4e-20	33.6	KIAA0147
AB033051	3.9e-19	29.7	KIAA1225
AB023148	1.7e-17	27.5	KIAA0931
AB011178	1.9e-15	28.2	KIAA0606
D86984	4.3e-15	27.4	KIAA0231

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 150 163 PR00019 Leucine-rich repeat

IPR001611 170 183 PR00019 Leucine-rich repeat

HMMPfam IPR001611 126 147 PF00560 Leucine-rich repeat

IPR001611 149 170 PF00560 Leucine-rich repeat

IPR001611 172 193 PF00560 Leucine-rich repeat

IPR001611 195 216 PF00560 Leucine-rich repeat

IPR001611 218 239 PF00560 Leucine-rich repeat

IPR001611 241 262 PF00560 Leucine-rich repeat

IPR001611 264 285 PF00560 Leucine-rich repeat

IPR001611 287 308 PF00560 Leucine-rich repeat

IPR001611 310 332 PF00560 Leucine-rich repeat

IPR001611 358 380 PF00560 Leucine-rich repeat

IPR001611 382 403 PF00560 Leucine-rich repeat

IPR001611 405 426 PF00560 Leucine-rich repeat

IPR001611 428 449 PF00560 Leucine-rich repeat

IPR001611 451 472 PF00560 Leucine-rich repeat

IPR001611 474 495 PF00560 Leucine-rich repeat

IPR001611 497 518 PF00560 Leucine-rich repeat

IPR001611 520 542 PF00560 Leucine-rich repeat

HMMSmart IPR003591 124 146 SM00369 Leucine-rich repeat

NULL 124 143 SM00364 NULL

NULL 124 142 SM00365 NULL

IPR003591 147 169 SM00369 Leucine-rich repeat

NULL 147 166 SM00364 NULL

NULL 170 189 SM00364 NULL

NULL 170 191 SM00365 NULL

IPR003591 170 192 SM00369 Leucine-rich repeat

NULL 193 218 SM00365 NULL

IPR003591 193 215 SM00369 Leucine-rich repeat

NULL 216 235 SM00364 NULL

IPR003591 216 237 SM00369 Leucine-rich repeat

IPR003591 239 262 SM00369 Leucine-rich repeat

NULL 239 258 SM00364 NULL

NULL 239 270 SM00365 NULL

NULL 262 281 SM00364 NULL

NULL 285 304 SM00364 NULL

IPR003591 285 308 SM00369 Leucine-rich repeat

NULL 308 327 SM00364 NULL

IPR003591 309 331 SM00369 Leucine-rich repeat

IPR003591 332 355 SM00369 Leucine-rich repeat

IPR003591 356 379 SM00369 Leucine-rich repeat

IPR003591 403 425 SM00369 Leucine-rich repeat

IPR003591 426 448 SM00369 Leucine-rich repeat

NULL 426 445 SM00364 NULL

NULL 449 468 SM00364 NULL

NULL 449 467 SM00365 NULL

IPR003591 449 471 SM00369 Leucine-rich repeat

NULL 472 491 SM00364 NULL

IPR003591 472 494 SM00369 Leucine-rich repeat

NULL 495 523 SM00365 NULL

IPR003591 495 516 SM00369 Leucine-rich repeat

NULL 495 514 SM00364 NULL

IPR003591 518 542 SM00369 Leucine-rich repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	150	163	PR00019	Leucine-rich repeat
IPR001611	170	183	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	126	147	PF00560	Leucine-rich repeat
IPR001611	149	170	PF00560	Leucine-rich repeat
IPR001611	172	193	PF00560	Leucine-rich repeat
IPR001611	195	216	PF00560	Leucine-rich repeat
IPR001611	218	239	PF00560	Leucine-rich repeat
IPR001611	241	262	PF00560	Leucine-rich repeat
IPR001611	264	285	PF00560	Leucine-rich repeat
IPR001611	287	308	PF00560	Leucine-rich repeat
IPR001611	310	332	PF00560	Leucine-rich repeat
IPR001611	358	380	PF00560	Leucine-rich repeat
IPR001611	382	403	PF00560	Leucine-rich repeat
IPR001611	405	426	PF00560	Leucine-rich repeat
IPR001611	428	449	PF00560	Leucine-rich repeat
IPR001611	451	472	PF00560	Leucine-rich repeat
IPR001611	474	495	PF00560	Leucine-rich repeat
IPR001611	497	518	PF00560	Leucine-rich repeat
IPR001611	520	542	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	124	146	SM00369	Leucine-rich repeat
NULL	124	143	SM00364	NULL
NULL	124	142	SM00365	NULL
IPR003591	147	169	SM00369	Leucine-rich repeat
NULL	147	166	SM00364	NULL
NULL	170	189	SM00364	NULL
NULL	170	191	SM00365	NULL
IPR003591	170	192	SM00369	Leucine-rich repeat
NULL	193	218	SM00365	NULL
IPR003591	193	215	SM00369	Leucine-rich repeat
NULL	216	235	SM00364	NULL
IPR003591	216	237	SM00369	Leucine-rich repeat
IPR003591	239	262	SM00369	Leucine-rich repeat
NULL	239	258	SM00364	NULL
NULL	239	270	SM00365	NULL
NULL	262	281	SM00364	NULL
NULL	285	304	SM00364	NULL
IPR003591	285	308	SM00369	Leucine-rich repeat
NULL	308	327	SM00364	NULL
IPR003591	309	331	SM00369	Leucine-rich repeat
IPR003591	332	355	SM00369	Leucine-rich repeat
IPR003591	356	379	SM00369	Leucine-rich repeat
IPR003591	403	425	SM00369	Leucine-rich repeat
IPR003591	426	448	SM00369	Leucine-rich repeat
NULL	426	445	SM00364	NULL
NULL	449	468	SM00364	NULL
NULL	449	467	SM00365	NULL
IPR003591	449	471	SM00369	Leucine-rich repeat
NULL	472	491	SM00364	NULL
IPR003591	472	494	SM00369	Leucine-rich repeat
NULL	495	523	SM00365	NULL
IPR003591	495	516	SM00369	Leucine-rich repeat
NULL	495	514	SM00364	NULL
IPR003591	518	542	SM00369	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTGTTGTTCTGCTTTTCCTG

Primer_r
: TCTTCACCTGCCTTCCATTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1846 bp
Genome contig ID	gi89161187f_112569363
PolyA signal sequence (TATAAA,-33)	+--------+--------+----*----+---- TTTATAAAAGGAATTTGTTTATTACAGCTCTACCT
Flanking genome sequence (194051 - 194100)	----+--------+--------+--------+--------+----* AGAGCTTGTGTGTTTGTGTGGTTTTTTAAATCTCGTATCCAGGTGTGTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	112669363	112763412	9	99.5	Perfect prediction

Primer_f	: ACTGTTGTTCTGCTTTTCCTG
Primer_r	: TCTTCACCTGCCTTCCATTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0862

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information