HUGE |
Gene/Protein Characteristic Table for KIAA0931 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK02004 |
---|---|
Accession No. : | AB023148 |
Description : | PH domain leucine-rich repeat protein phosphatase-like. |
HUGO Gene Name : | PH domain and leucine rich repeat protein phosphatase-like (PHLPPL) |
Clone Name : | bf00159 [Vector Info] |
Flexi ORF Clone : | pF1KA0931
![]() |
Source : | Human adult brain |
Note : | We replaced hh03806, former representative clones for KIAA0931 with bf00159. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8449 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3952 bp Genome contig ID gi51511732r_70136393 PolyA signal sequence
(AATAAA,-33) +----*----+----*----+----*----+----
AAAATAAAGTGGAATCTTTTTCATGGCTTTGTTTTFlanking genome sequence
(99939 - 99890) ----+----*----+----*----+----*----+----*----+----*
AAAATGGAGTGCTTGTTATTTCATAAGTATTTTAGCATGAAGCTATAATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 70236332 70317366 21 99.0 Both No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1258 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGTCAGTCACACATAAGTTCC | |
: GTAAGATATGAGCCCACTGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |