HUGE |
Gene/Protein Characteristic Table for KIAA0931 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK02004 |
---|---|
Accession No. : | AB023148 |
Description : | PH domain leucine-rich repeat protein phosphatase-like. |
HUGO Gene Name : | PH domain and leucine rich repeat protein phosphatase-like (PHLPPL) |
Clone Name : | bf00159 [Vector Info] |
Flexi ORF Clone : | pF1KA0931
![]() |
Source : | Human adult brain |
Note : | We replaced hh03806, former representative clones for KIAA0931 with bf00159. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8449 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3952 bp Genome contig ID gi51511732r_70136393 PolyA signal sequence
(AATAAA,-33) +----*----+----*----+----*----+----
AAAATAAAGTGGAATCTTTTTCATGGCTTTGTTTTFlanking genome sequence
(99939 - 99890) ----+----*----+----*----+----*----+----*----+----*
AAAATGGAGTGCTTGTTATTTCATAAGTATTTTAGCATGAAGCTATAATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 70236332 70317366 21 99.0 Both No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1258 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 574 | 587 | PR00019 | Leucine-rich repeat |
IPR001611 | 602 | 615 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 302 | 323 | PF00560 | Leucine-rich repeat |
IPR001611 | 325 | 346 | PF00560 | Leucine-rich repeat | |
IPR001611 | 348 | 369 | PF00560 | Leucine-rich repeat | |
IPR001611 | 371 | 392 | PF00560 | Leucine-rich repeat | |
IPR001611 | 442 | 464 | PF00560 | Leucine-rich repeat | |
IPR001611 | 528 | 550 | PF00560 | Leucine-rich repeat | |
IPR001611 | 551 | 572 | PF00560 | Leucine-rich repeat | |
IPR001611 | 573 | 595 | PF00560 | Leucine-rich repeat | |
IPR001611 | 604 | 625 | PF00560 | Leucine-rich repeat | |
IPR014045 | 719 | 961 | PF00481 | Protein phosphatase 2C | |
HMMSmart | NULL | 300 | 319 | SM00364 | NULL |
NULL | 323 | 342 | SM00364 | NULL | |
IPR003591 | 323 | 345 | SM00369 | Leucine-rich repeat | |
NULL | 346 | 365 | SM00364 | NULL | |
IPR003591 | 346 | 368 | SM00369 | Leucine-rich repeat | |
NULL | 369 | 388 | SM00364 | NULL | |
IPR003591 | 369 | 391 | SM00369 | Leucine-rich repeat | |
IPR003591 | 461 | 484 | SM00369 | Leucine-rich repeat | |
IPR003591 | 502 | 526 | SM00369 | Leucine-rich repeat | |
NULL | 503 | 522 | SM00364 | NULL | |
NULL | 526 | 545 | SM00364 | NULL | |
IPR003591 | 527 | 549 | SM00369 | Leucine-rich repeat | |
NULL | 549 | 568 | SM00364 | NULL | |
IPR003591 | 551 | 571 | SM00369 | Leucine-rich repeat | |
IPR003591 | 574 | 594 | SM00369 | Leucine-rich repeat | |
NULL | 574 | 590 | SM00364 | NULL | |
IPR003591 | 602 | 625 | SM00369 | Leucine-rich repeat | |
NULL | 602 | 621 | SM00364 | NULL | |
NULL | 625 | 644 | SM00364 | NULL | |
IPR003591 | 647 | 671 | SM00369 | Leucine-rich repeat | |
IPR001932 | 710 | 966 | SM00332 | Protein phosphatase 2C-related |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGTCAGTCACACATAAGTTCC | |
: GTAAGATATGAGCCCACTGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |