HUGE

Gene/Protein Characteristic Table for KIAA0644

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00587
Accession No. :	AB014544
Description :
HUGO Gene Name :
Clone Name :	hj03618 [Vector Info]
Flexi ORF Clone :	pF1KSDA0644
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4933 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 887 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_055632	0	99.9	hypothetical pr...	Homo sapiens
XP_001088293	0	96.2	similar to CG75...	Macaca mulatta
BAC34634	0	88.6	unnamed protein...	Mus musculus
XP_001381576	1.2e-212	76.8	hypothetical pr...	Monodelphis dom...
XP_539495	1.1e-181	88.1	similar to Carb...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007876	5.8e-11	28.6	KIAA0416
AB018349	1e-07	27.0	KIAA0806
AB011537	1.4e-06	26.1	KIAA0813
AB033072	3.1e-06	32.6	KIAA1246
AB011538	4e-06	27.3	KIAA0814

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 161 174 PR00019 Leucine-rich repeat

IPR001611 376 389 PR00019 Leucine-rich repeat

HMMPfam IPR001611 160 182 PF00560 Leucine-rich repeat

IPR001611 184 206 PF00560 Leucine-rich repeat

IPR001611 208 230 PF00560 Leucine-rich repeat

IPR001611 232 254 PF00560 Leucine-rich repeat

IPR001611 256 278 PF00560 Leucine-rich repeat

IPR001611 306 328 PF00560 Leucine-rich repeat

IPR001611 330 352 PF00560 Leucine-rich repeat

IPR001611 354 376 PF00560 Leucine-rich repeat

IPR001611 378 400 PF00560 Leucine-rich repeat

IPR001611 402 424 PF00560 Leucine-rich repeat

IPR000483 463 491 PF01463 Cysteine-rich flanking region

HMMSmart IPR003591 158 181 SM00369 Leucine-rich repeat

IPR003591 182 205 SM00369 Leucine-rich repeat

IPR003591 206 229 SM00369 Leucine-rich repeat

IPR003591 230 253 SM00369 Leucine-rich repeat

IPR003591 254 277 SM00369 Leucine-rich repeat

IPR003591 278 303 SM00369 Leucine-rich repeat

IPR003591 304 327 SM00369 Leucine-rich repeat

IPR003591 328 351 SM00369 Leucine-rich repeat

IPR003591 352 375 SM00369 Leucine-rich repeat

IPR003591 376 399 SM00369 Leucine-rich repeat

IPR003591 400 423 SM00369 Leucine-rich repeat

IPR000483 435 491 SM00082 Cysteine-rich flanking region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	161	174	PR00019	Leucine-rich repeat
IPR001611	376	389	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	160	182	PF00560	Leucine-rich repeat
IPR001611	184	206	PF00560	Leucine-rich repeat
IPR001611	208	230	PF00560	Leucine-rich repeat
IPR001611	232	254	PF00560	Leucine-rich repeat
IPR001611	256	278	PF00560	Leucine-rich repeat
IPR001611	306	328	PF00560	Leucine-rich repeat
IPR001611	330	352	PF00560	Leucine-rich repeat
IPR001611	354	376	PF00560	Leucine-rich repeat
IPR001611	378	400	PF00560	Leucine-rich repeat
IPR001611	402	424	PF00560	Leucine-rich repeat
IPR000483	463	491	PF01463	Cysteine-rich flanking region
HMMSmart	IPR003591	158	181	SM00369	Leucine-rich repeat
IPR003591	182	205	SM00369	Leucine-rich repeat
IPR003591	206	229	SM00369	Leucine-rich repeat
IPR003591	230	253	SM00369	Leucine-rich repeat
IPR003591	254	277	SM00369	Leucine-rich repeat
IPR003591	278	303	SM00369	Leucine-rich repeat
IPR003591	304	327	SM00369	Leucine-rich repeat
IPR003591	328	351	SM00369	Leucine-rich repeat
IPR003591	352	375	SM00369	Leucine-rich repeat
IPR003591	376	399	SM00369	Leucine-rich repeat
IPR003591	400	423	SM00369	Leucine-rich repeat
IPR000483	435	491	SM00082	Cysteine-rich flanking region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 772 QLLTLALLTVNALLVLLALAAWA 794 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	772	QLLTLALLTVNALLVLLALAAWA	794	PRIMARY	23

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAGCAGGGTAATATTGAGTC

Primer_r
: AAGTAGAACACAGATCCAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCAGCAGGGTAATATTGAGTC
Primer_r	: AAGTAGAACACAGATCCAGGC
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0644

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information